... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>181) - www.genebee.msu.ru/ )

• Fasta3 help
• INTAS :: Global and Local Protein Matching
• BLAST 2.0 Release Notes

... Pes muscles and their action in giant anteater Myrmecophaga tridactyla (Myrmecophagidae, Pilosa) compared with other plantigrade mammals . ... The list of mammal species inhabited the Russian coastal territories of the gulf and adjacent islands is provided. ... Circadian activity rhythms of dwarf hamsters ( Phodopus spp. ) under laboratory and semi-natural conditions . ... The observed activity patterns are similar to those obtained under constant, standardized conditions. ...

Еще в разделе: (Показать все результаты (>5528) - zmmu.msu.ru/ )

• Pes muscles and their action in giant anteater Myrmecophaga tridactyla

Gol'dman N. L. Properties of solutions of parabolic equations with unknown coefficients // Differential Equations. 2011. ... 60-69. In this paper statements in Holder spaces for ill-posed inverse problems with final overdetermination are studied for parabolic equations with unknown coefficients multiplying lower-order terms or lower-order derivatives. ... Such approach relates the uniqueness problem considered to uniqueness property for linear backward parabolic operators. ...

Еще в разделе: (Показать все результаты (>108) - srcc.msu.ru/ )

• Mitrokhin S. I. Spectral Properties of a Fourth-Order Differential Operator
• D.Moss, D.Sokoloff, R.Beck, M.Krause Galactic winds and the symmetry properties
• Митрохин С. И. Spectral Properties of Boundary Value Problems for

Fortran-DVM Compiler . Detailed design . ... 3.1 Parsing . 3.2 Transforming parse tree . 3.3 Generating code in Fortran 77 . ... 4.2 Symbol and Type table . ... This report presents the detailed description of the Fortran-DVM (FDVM) compiler implementation. ... The input to the compiler is source code in Fortran DVM or HPF-DVM language. ... It is designed as an open C++ class library that provides a set of parsers, a structured parse tree, a symbol and type tables for a user. ... dvm.cpp . ...

Еще в разделе: (Показать все результаты (>138) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description

... We have studied the influence of the N-terminal cluster of hydrophobic aminoacid residues on biological activity of Ltc2a. The deletion of four N-terminal residues one by one resulted in a gradual decrease in haemolytic activity and bactericidal effect against Staphylococcus aureus , whereas activity against Gram-negative bacteria was affected weakly. ... The truncation leads to a decrease in binding affinity at zwitterionic membranes that correlates strongly with a decrease in haemolytic activity. ...

Еще в разделе: (Показать все результаты (>89) - www.msm.biophys.msu.ru/ )

... We computed the permanently shadowed areas and temperatures inside the craters for the variation of the position of the lunar pole of rotation with respect to the ecliptic pole with a period of 18.6 years. ... According to our results, the total permanently shadowed area in the polar craters of the Moon is equal to 50428.7 km2, or 0.13% of the total area of the lunar surface [3]. ... The area of permanently shaded part of a crater makes 59 % from all area of a crater [3]. ...

Еще в разделе: (Показать все результаты (>103) - selena.sai.msu.ru/ )

• Шевченко Владислав Владимирович
• Ekaterina A. Kozlova
• Mikhail V. Goryachev

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... VS'08 properties editor ToolStripMenuItem . ... Re: VS'08 properties editor ToolStripMenuItem [ re: Yorik ] . ... Re: VS'08 properties editor ToolStripMenuItem [ re: Orient ] . ...

Еще в разделе: (Показать все результаты (>1664) - www.fds-net.ru/ )

• PhD по химии - Public forum of MSU united student networks
• получил отзыв - Public forum of MSU united student networks
• что-то типа reference manager для Linux - Public forum of MSU united student

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Technological Institute for Superhard and Novel Carbon Materials . ... Therefore, in solving the problems will be applied as specialized methods for the study of polyatomic structures - the method of empirical potentials Brenner . ... AREA: Condensed Matter Physics, Theoretical Physics, Physical Chemistry . ... Moscow State Uiversity . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>67) - hpc.msu.ru/ )

• APPLICATIONS: Inorganic Chemistry | Moscow University Supercomputing Center
• APPLICATIONS: Geology | Moscow University Supercomputing Center
• APPLICATIONS: Informatics | Moscow University Supercomputing Center

THE STRUCTURE AND PROPERTIES OF MONOMOLECULAR FILMS BASED ON N-OCTADECYL-3,4,:9,10-PERYLENE-BIS(DICARBOXYDIIMIDE) . ... Atomic force microscopy, ellipsometry, and piezoquartz microweighing techniques were used to study the characteristic of N-octadecyl-3,4:9,10-perylene-bis(dicarboxydiimide) monomolecular layers depending on the conditions of isolation and the nature of substrate. ...

Еще в разделе: (Показать все результаты (>93) - www.spm.genebee.msu.ru/ )

• Interests
• List of my publications issued in 1996-2002

Nominal modification at the Syntax-Semantics Interface: comparing attributive adjectives in Italian and English In his seminal work, Bolinger (1967) discusses an asymmetry between two functions that adjectives can perform, namely attributive and predicative modification; furthermore, he points out that the syntactic asymmetry between the pre- and the post-nominal position of a number of adjectives in English is related to a semantic difference between reference- and referentmodification, respectively. ...

Еще в разделе: (Показать все результаты (>308) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/fdsl/abstracts/biskup.pdf
• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/zakharov-2007/congr_2.doc
• http://www.philol.msu.ru/~otipl/new/mscl/2008/abstracts/oskolskaya.pdf

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... PhD по химии . ... Its spin transition behavior is . ... spin transition - iron complexes - material chemistry - molecular switches. ...

Еще в разделе: (Показать все результаты (>832) - www.snto-msu.net/ )

• как скомпилировать прогу на MFC в .Net ? - Public forum of MSU united student
• Проблемы с MSDN, что c VS2005 Feb CTP - Public forum of MSU united student
• Узнать цвет пикселя. Работа с видеопамятью. С/С++ [ + OpenGL ? ]. - Public

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>13) - lcc.chem.msu.ru/ )

VIII Mendeleev Congress on General and Applied Chemistry , Moscow , 2007 2489 DESIGN OF GREEN CHEMICALS AND BIOMATERIALS WITH TAILORED PROPERTIES BASED ON HUMIC SUBSTANCES Perminova I.V., Karpiouk L.A., Ponomarenko S.A.b, Kovalenko A.N., Shcherbina N.S.a, Bolkova A.N., Kulikova N.A.c, Tsvetkova E.A.d, Muzafarov A.M.b, Petrosyan V.S.a Department of Chemistry , Lomonosov Moscow State University, Moscow 119992, ... The Path Forward for Biofuels and Biomaterials. ...

Еще в разделе: (Показать все результаты (>156) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2007/kovalenko-using-2007.pdf
• http://www.mgumus.chem.msu.ru/arw/database-sheet.doc
• http://www.mgumus.chem.msu.ru/publication/2008/2008-shcherbina-interaction.pdf

This section contains information of how user agents should treat control characters and other special characters. ... There are 256 character positions in the Latin-1 encoding. ... It consists of the space character, 186 characters that form a subset of the graphic characters in ISO 6937/2 (1983), and four additional characters that are intended for inclusion in ISO 6937/2. ... Certain characters are taken to have special meaning within the context of an HTML document. ...

Еще в разделе: (Показать все результаты (>222) - comet.sai.msu.ru/ )

• The Head Element and Related Elements
• Collection of Net References - Frame version
• References

Participants of the project . Scientific information . ... Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University – chief developer and executor. Physics-Technical Faculty of Ulyanovsk State University. Kostroma State University. ... Contains information about space weather based on the data from GOES, ACE satellites. The project of a supersmall satellite "Baumanets" , developed by the students of Bauman Moscow State Technical University. ...

Еще в разделе: (Показать все результаты (>38) - cosmos.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>24) - engineering.phys.msu.ru/ )

• Circuit Diagnostics
• Introduction to Linux
• FPGA Design

Galaxy Zoo Catalogs the Universe . ... Credit Copyright: SDSS , Galaxy Zoo ; Composite: Richard Nowell Hannah Hutchins Explanation: You, too, can Zoo. The Galaxy Zoo project has been enabling citizen scientists -- inquisitive people like yourself armed with only a web browser-- to sort through the universe. ... Pictured above, a group of vibrant mergers found by Zooites demonstrates the diverse zoo-like nature of many interacting galaxies in the universe. ... NASA Official: Jay Norris. ...

Еще в разделе: (Показать все результаты (>5354) - www.astronet.ru/ )

• Астронет > References materials

Polarisation properties of single-mode biphotons . Volume 35 (2005) . ... Pages 69-79 . L A Krivitskii , S P Kulik , G A Maslennikov , M V Chekhova . ... From the viewpoint of their polarisation properties, they represent qutrits, i.e., three-dimensional quantum systems, and are quite promising for quantum information applications. ... L A Krivitskii, S P Kulik, G A Maslennikov, M V Chekhova, "Polarisation properties of single-mode biphotons", Quantum Electron. ... Download PDF file (352 kB) . ...

Еще в разделе: (Показать все результаты (>69) - qi.phys.msu.ru/ )

• PUBLIC
• Sergei Kulik: Scientific interest

September 29, 2011 . ... 10.00-13.30 Chair: I. Lokhtin . ... Search for heavy neutrino in KБ†’нјнЅнЕ decay at ISTRA+ setup . ... Heavy flavours and QCD studies at HERA . ... V. Popov (SINP MSU) . ... D. Melikhov (SINP MSU) . ... 15.30-17.10 Parallel section A: Physics beyond the SM and Cosmology, Chair: D. Gorbunov . ... I. Volobuev (SINP MSU) . ... 17.30-19.10 Parallel section A: QCD, Chair: N. Zotov . 17.30 . ... 17.30 - 19.10 Parallel section B: Gravity Theory , Chair: M. Smolyakov . ...

Еще в разделе: (Показать все результаты (>173) - qfthep.sinp.msu.ru/ )

• June 28, 2013
• QFTHEP'2015 Proceedings