1) Soil Science Faculty, Moscow State University, Moscow 119899, Russia . 2) Faculty of Physics, Moscow State University, Moscow 119899, Russia . ... Long-term response of sandy podzols to acid deposition near the nickel smelter in the Kola Peninsula, north-western Russia, was evaluated with the SMART model. The present acid load does not effect considerably on forest soils in background areas. The dramatic shift in soil chemistry near the smelter is expected within several decades. ...

Еще в разделе: (Показать все результаты (>17) - eco.soil.msu.ru/ )

... Simulation of an ideal quantum computer on a supercomputer "Lomonosov"' . ... This paper presents a simulation of an ideal quantum computer on a supercomputer "Lomonosov". ... Korzh O.V., e-mail: oxanad@mail.ru ; Korobkov S.V., e-mail: korobkovserg@gmail.com ; тАУ Moscow State University, Faculty of Computational Mathematics and Cybernetics; Leninskiye Gory 1-52, Moscow, 119991, Russia . ... Korzh A.A., e-mail: anton@korzh.ru тАУ T-Platforms Company; prospect Leninskii 113, Moscow, 117198, Russia . ...

Еще в разделе: (Показать все результаты (>235) - num-meth.srcc.msu.ru/ )

• "A maximum entropy reconstruction technique for tomographic particle image
• "On the problem of synthesis of nano-optical elements"

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>34) - ideas.msu.ru/ )

Moss D., Sokoloff D., Resonances for activity waves in spherical mean field dynamos, eprint arXiv:1211.2414, 6 pages, 6 figures, 2012. We study activity waves of the kind that determine cyclic magnetic activity of various stars, including the Sun, as a more general physical rather than a purely astronomical problem. We try to identify resonances which are expected to occur when a mean-field dynamo excites waves of quasi-stationary magnetic field in two distinct spherical layers. ...

Еще в разделе: (Показать все результаты (>105) - srcc.msu.ru/ )

• D.Moss, D.Sokoloff, Seed fields for galactic dynamos, Astron. Astrophys.

... Phys. Solid State 30 , N 2, 303 (1988). ... An X-ray diffraction investigation was made of the distortions of the fcc lattice in a series of solid solutions of IV-VI semiconductors in which low-temperature phase transitions were expected. ... Keywords: semiconductor solid solutions, lead tin telluride, lead telluride sulfide, lead germanium telluride, lead germanium telluride selenide, indium, sulfur, Curie temperature . ...

Еще в разделе: (Показать все результаты (>94) - scon155.phys.msu.su/ )

... Physical Chemistry Division , . Department of Chemistry , . M.V.Lomonosov Moscow State University , . Moscow 119991 Russian Federation . ... Undergraduate student, Special Group for Physical Chemistry, Chemistry Department, Moscow State University. ... Physical Chemistry . ... 2005 - International Mendeleev's Chemistry Olympiad, Tajikistan - Silver Medal . 2006 - International Mendeleev's Chemistry Olympiad, Armenia - Gold Medal . ...

Еще в разделе: (Показать все результаты (>6) - lcc.chem.msu.ru/ )

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>179) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services Help
• BLAST Reference Manual Pages

PRL 102, 118302 (2009) PHYSICAL REVIEW LET TE RS week ending 20 MARCH 2009 Direct Measurements of Hydrophobic Slippage Using Double-Focus Fluorescence Cross-Correlation Olga I. Vinogradova,1 Kaloian Koynov,2 Andreas Best,2 and Francois Feuillebois3 ... 75231 Paris Cedex 05, France (Received 29 January 2008; published 20 March 2009) We report the results of direct measurements of velocity profiles in a microchannel with hydrophobic and ... FIG. ... Phys. 119, 13106 (2003). ...

Еще в разделе: (Показать все результаты (>34) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/pre2006e.pdf
• http://nanofluidics.phys.msu.ru/paper/JCP2014.pdf
• http://nanofluidics.phys.msu.ru/paper/jcp2012_2.pdf

Estimation of selection pressure on degenerate sequences in genomes: choice of method I.S. Rusinov,1 A.S. Ershova, 1 2,3,4 A.S. Karyagina, 2,3,4 S.A. Spirin, 1,2,5 A.V. Alexeevski 1,2,5 Lomonosov Moscow State University, Faculty of Bioengineering and Bioinformatics, Moscow 119992, Russia;2Lomonosov Moscow State University, Belozersky Institute of Physical and Chemical Biology, Moscow 119992, Russia; 3Gamaleya Institute of Epidemiology and Microbiology, ...

Еще в разделе: (Показать все результаты (>204) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/129.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/48.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/19.pdf

... A barrel consisting of scintillation crystals has several advantages over a lead-scintillator design, including higher sensitivity and greater ease of segmentation. ... The CsI detector (called CID) consists of two parts: a CsI Barrel (CIB) of 10 rings with 18 crystals per ring; and a single upstream 1%crystal CsI Ring (CIR) with somewhat larger crystals than those in the barrel. ... Diagram of a CsI crystal. ... Shown in Fig. 12 is a typical pulse-height spectrum for one crystal for a halo data run...

Еще в разделе: (Показать все результаты (>116) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/report97_monet.ps
• http://lav01.sinp.msu.ru/nir/papers/NIM_2prot-LGD.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_3000-LGD.pdf

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• ConClus

. The work is supported by the Russian Foundation for Basic Research, grant 10-07-00685-a . PDB . Classification . Domain instances . Bonded with NA . 1E8O . SIGNALING PROTEIN/RNA . 2 . 2 . 1E8S . SIGNALING PROTEIN/RNA . 1 . 0 . 1RY1 . TRANSLATION . 1 . 1 . total (3 entries) . 4 . 3 . No comments on this family . Send your questions and comments to sas@belozersky.msu.ru .

Еще в разделе: (Показать все результаты (>104) - monkey.belozersky.msu.ru/ )

• PDB entries containing domains of the family "Signal recognition particle 14kD
• SCOP classification

... According to the relational (or relative ) principle , the properties of a model clock represent the properties of physical time. ... In the postulated basic equation, the increment of time is expressed through the average value of increments of spatial coordinates of particles of the system under consideration, and time and space are closely connected. ... Thus the nature of physical time is treated in a constructive manner: one should consider time as a dependent variable. ...

Еще в разделе: (Показать все результаты (>437) - chronos.msu.ru/ )

• A.P.Levich. What we expect from studying time
• Laboratory-chair "Time as a phenomenon of the Universe expansion"
• Laboratory-chair of Discrete mechanics on a microscopic scale

... The Science Operation Department is composed of Astronomers, Telescope Instruments Operators(TIOs) and Data Handling Administrators(DHAs). ... Astronomers have proposed several methods to quantitatively measure the amount of turbulence above the telescope, which the most common ones is Differential Image Motion Monitor (DIMM). In optical testing, the Hartmann test is the common method to test the quality of optical components. ... Hartmann mask consists of 48 lenses. ...

Еще в разделе: (Показать все результаты (>30) - site2010.sai.msu.ru/ )

• Information

... Сайт МГУ . ... Дистанционные олимпиады Факультета иностранных языков и регионоведения Интервью заместителя декана по информационно-образовательным технологиям Назаренко Аллы Леонидовны. фото дня Фоторепортаж с "Дня первокурсника" . ... Центр дистанционного образования МГУ имени М.В.Ломоносова предлагает школьным учителям обучение по следующим программам повышения квалификации: . ... Добавлена информация о дистанционной программе MBA Экономического факультета МГУ . ... и непрерывного образования МГУ,...

Еще в разделе: (Показать все результаты (>3) - www.distance.msu.ru/ )

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>1228) - swx.sinp.msu.ru/ )

• SWX - Космическая погода