34th Meeting of the German Association for Acoustics (DAGA 2008) March 10 - 13, 2008, Dresden, Germany Deadline for abstract submission: November 1, 2008 . 11th European Mechanics of Materials Conference (MECAMAT) "Mechanics of microstructured solids: cellular materials, fibre reinforced solids and soft tissues" March 10 - 14, 2008, Turin, Italy Deadline for abstract submission: November 15, 2007 . ... 20th International Congress on Acoustics (ICA2010) August 23 - 27, 2010, Sydney, Australia . ...

Еще в разделе: (Показать все результаты (>44) - acoustics.phys.msu.ru/ )

• A.V.Shanin

... Malkhazova S.M. (ecology, medical geography), Doctor of Geography. ... Biology, Ecology with the fundamentals of biogeography , Biogeographic basis for nature conservation, Mathematical methods in biogeography , Methods of field studies, Diversity of organisms, Ecology of human, Biogeographical mapping , GIS in biogeography and ecology , Ecology of organisms, Biogeography of foreign countries, Biogeography of Russia, Bioindication and Biomonitoring, Geography of utilization of ...

Еще в разделе: (Показать все результаты (>29) - eng.geogr.msu.ru/ )

About That Humics Joe Bloggs1, John Doe2, Juan Perez3 1Institute for Humic Materials, City, Country, JoeBloggs@humic.edu 2University of Humics, City, Country 3Academy for Humic Design, City, Country Please prepare your abstract according to this template using provided styles: AbstractTitle, AbstractAuthors, AbstractAffiliation, AbstractText, AbstractFigure, AbstractTableName. The abstract should be strictly one page including figures and tables. ... The maximum file size is 5 MB. ...

Еще в разделе: (Показать все результаты (>120) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/hit-2014/docs/abstract_template%5Bhit-2014%5D.doc
• http://www.mgumus.chem.msu.ru/hit-2010/docs/abstract_template%5BHIT-2010%5D.doc
• MGUMUS -- Irina V. Perminova

Вертикальное распределение, скорости миграции и модели сравнения для актиния в полузасушливой местности [Нью-Мексико]. ... 2006. ... С. 199-211. ... Представлены результаты наблюдений, выполненных на военно-воздушной базе Карлтлэнд (Нью Мехико). ... Расчеты по диффузионной модели и модели выщелачивания дали близкие результаты скорости миграции актиния в диапазоне 0,009-0,1 см/г, причем более высокие для более глубоких слоев почвы. ключевые слова: . ...

Еще в разделе: (Показать все результаты (>31) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0301000451
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=28&from=&ref_ind=0210000232

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... TITLE . ... Abe K. On the equivariant diffeomorphism group of a smooth G-manifold and its application . Akhmetjev P. M. Cyclic structures on self-intersections of skew-framed immersed manifolds . ... Balashchenko V. V. Canonical structures on generalized symmetric spaces and Solovyov's formula . ... Bokan N. Curvature symmetries of manifolds with Grassman structure . ... Ershov A. V. Some homotopic invariants related to algebra bundles . ... Skopenkov A. B. Inertia groups of smooth embeddings . ...

Еще в разделе: (Показать все результаты (>188) - dfgm.math.msu.su/ )

• Носовский Г.В. / Кафедра Дифференциальной геометрии и приложений /

M. A. Vorotyntsev 1 1,2,3, D. V. Konev3, M. Skompska 4 ICMUB-UMR 6302 CNRS, Universite de Bourgogne, Dijon, France 2 M. V. Lomonosov Moscow State University, Russia 3 Institute for Problems of Chemical Physics, Chernogolovka, Russia 4 University of Warsaw, Poland mivo2010@yandex.com, mv@elch.chem.msu.ru, mv@u-bourgogne.fr In situ measurements of specific conductivity of films on electrode surface Specific conductivity: function of potential Impedance problems: 1. ... Which thickness? ...

Еще в разделе: (Показать все результаты (>66) - electr003.chem.msu.ru/ )

• Nanostructured SnO2-TiO2 films as related to lithium intercalation

Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...

Еще в разделе: (Показать все результаты (>34) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2007_Bonferroni_JOB.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2002_Host_manip_IJP.pdf

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>6) - bioinf.fbb.msu.ru/ )

• SDPlight
• SDPpred

... A. Smekhova, and K. Potzger, "Defects in Magnetic TiO2", Abstract Book of European School of Magnetism, 25.208.3.2013, CargeseCorsica, (2013) O. Yildirim, S. Cornelius, M. Vinnichenko, M. Butterling, A. Orlov, A. Wagner, A. Smekhova, and K. Potzger, "Magnetic and Defect Properties of Co Implanted TiO2", Abstract Book of Deutsche Physikalische Gesellschaft Spring Meeting, 11.315.3.2013, Regensburg, Germany (2013) A. Smekhova, R. Baulin, F. Pankratyev, A. Semisalova, A. Novikov, Yu. ...

Еще в разделе: (Показать все результаты (>17) - magn.phys.msu.ru/ )

• http://magn115.phys.msu.ru/Rus/DETI2/smekhova.html
• РФФИ 11-02-00906, отчет 2011
• Сотрудники кафедры магнетизма: Радковская Анна Александровна

... List of all selected researchers by country of host institution (in alphabetical order within each country group): http :// erc.europa.eu / pdf / ERC _StG2010Results_All_by_Country. pdf Lists of selected researchers by domain (in alphabetical order): Social Sciences and Humanities: http :// erc.europa.eu / pdf / ERC _StG2010Results_SH. pdf Life Sciences: http :// erc.europa.eu / pdf / ERC _StG2010Result