... Please retype /font /b /td /tr % } tr td class = form nbsp; b Your name: /b /td td class =formi input type=text size= 60 value= %$ author % name= author /td /tr tr td class = form nbsp; b Your e-Mail: /b /td td class =formi input type=text size= 60 value= %$ dbh->quote($author) . ... br>"); return -1; } my $last_id=DB_functions::get_max_id($dbh,$tree,'id'); my $parent = ($id>0)?$id:0; if (!$dbh->do("INSERT INTO $tree (id,parent,resource) VALUES ( $last_id," . ...

Еще в разделе: (Показать все результаты (>71) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/includes/forum/showmessage.msn

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• ANTARES в МГУ

... Поступление иностранных граждан . ... Russian Language Program . ... General Russian Courses . Courses of Russian for Specific Purposes . How to Register for a Course and Receive the Entrance Visa . ... The Faculty of Foreign Languages and Area Studies at Moscow State University offers courses of General Russian to learners of all levels from Absolute Beginners through to Advanced. ... If you would like to register for a course please provide us with the following information: . ...

Еще в разделе: (Показать все результаты (>107) - ffl.msu.ru/ )

... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...

Еще в разделе: (Показать все результаты (>5) - depository.msu.ru/ )

• Contact | depozitariy

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• ConClus

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

Главная Международные связи Иностранным студентам/ Incoming students . ... Semester Dates for International Students: . ... In case of institutional agreement on international student exchange the program is free of charge. ... All students should come to Russia by Moscow State University invitation. ... Students enter Russia with a single-entry visa. ... Exams/Passes . ... Pass . ...

Еще в разделе: (Показать все результаты (>68) - www.mgubs.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Другие названия журнала: Synth. Comm , Synthetic Communication . ... Borisova Nataliya E. , Gulevich Tatiana G. , Reshetova Marina D. , Knizhnikov Valeri A. в журнале Synthetic Communications , издательство Marcel Dekker Inc. ... в журнале Synthetic Communications , издательство Marcel Dekker Inc. ...

Еще в разделе: (Показать все результаты (>3036) - istina.msu.ru/ )

• Manfred Sneps-Sneppe - сотрудник | ИСТИНА - Интеллектуальная Система
• Voloshin Yan Z. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Nature communications - журнал | ИСТИНА - Интеллектуальная Система

The conference will take place at the Mathematical Research and Conference Center in Bedlewo , near Poznan. You can easily get to Poznan by train from Warsaw or Berlin. The participants are expected to arrive to Bedlewo on January 25. There will be reserved a bus from the Poznan train station "Poznan Glowny" to Bedlewo. Please wait for the bus in front of the main entrance of the station. The bus departure is expected to be at 7:00 p.m. There is also a small airport in Poznan. ...

Еще в разделе: (Показать все результаты (>138) - higeom.math.msu.su/ )

• C*-algebras: Arrival

This page is devoted to information on Supernova 1999dq in NGC 976 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main supernova page. Information on the original web pages for many of these images can be found on the Supernova links web page. Supernova 1999dq is the 24th LOSS discovery this year. ... VSNET Light curve (requires JAVA). ... vsnet-alert 3442 ] SNe 1999dp and 1999dq . vsnet-chat 2285 ] Host galaxy of SN1999dq . ...

Еще в разделе: (Показать все результаты (>50) - www.rochesterastronomy.org/ )

• Supernova 1999ee and 1999ex in IC 5179
• Supernova 1999ev in NGC 4274
• Images of Supernova 1998S in NGC 3877

FP7 / PEOPLE / Marie Curie Actions PROPHET - ITN (FP7-PEOPLE-2010-ITN) Grant Agreement no. 264687 Postgraduate Research on Photonics as an Enabling Technology Job title: Quantum Dot based mode locked lasers for optical frequency combs Job summary PROPHET (Postgraduate Research on Photonics as an Enabling Technology - www.prophet-itn.eu ) is a Marie Curie Initial Training Network funded by the EU FP7. ... The ESR will be admitted to the University of Paris 6, to pursue a PhD thesis. ...

Еще в разделе: (Показать все результаты (>461) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > EXPECT
• Студенческий форум Физфака МГУ > Каррент мьюзик
• Студенческий форум Физфака МГУ > Новый журнал Call for Papers

... Conference Schedule . ... Visa Support NEW! ... Registration . For registration at the 14th International Meeting of the International Humic Substances Society (IHSS) please download the Registration Form , fill it in, and send to the Conference Secretariat by e-mail ihss@org.chem.msu.ru . ... Registration Fee and/or Accommodation and/or Social Fee for Participation at the IHSS-14 Conference from " Full NAME of Participant(s) " . ... September 13, 2008, 9 a.m. - 9 p.m. - Arrival Day . ...

Еще в разделе: (Показать все результаты (>125) - mgumus.chem.msu.ru/ )

• Humates NATO ARW Home Page

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>28) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... There is no trigger -- channels are sampled continuously and written first to disk, later to tape Total data rate from each interferometer: ~3 MB/sec Gravitational wave channel is only ~2% of the data stream Data to be archived: ~100-200 TB per year ACAT 2002 Peter Shawhan ( LIGO / Caltech ) Gravitational-Wave Data Analysis Different scientific topics require different ...

Еще в разделе: (Показать все результаты (>57) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-04-Security1.pdf
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-02-Basics1.pdf

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Congratulations to Olga Senyukova, who has received CMC scholarship for young scientists and teachers who achieved significant results in teaching and research activities. ...

Еще в разделе: (Показать все результаты (>346) - graphics.cs.msu.ru/ )

• Congratulations to Olga Senyukova and Mikhail Erofeev who have received MSU
• Smart removal of blocking effects from video | Лаборатория компьютерной графики
• Smart removal of blocking effects from video | Graphics and Media Lab

. Home . News . Studying at MU . Exchanges . Contacts . Search . Contacts . Yulia Yu. VORONOVICH . Coordinator . Germany, Liechtenstein, Luxembourg . Send an e-mail to this Contact: . Enter your name: . E-mail address: . Message subject: . Enter your message: . Lomonosov Moscow State University . International Relations Office 2007-2008

Еще в разделе: (Показать все результаты (>16) - www.ied.msu.ru/ )

... View Latest Revision . Revision Log Mode: Stop on copy Follow copies Show only adds and deletes View log starting at and back to . Show at most revisions per page. Show full log messages . Added . ... Log Message . ... Alex Martynov . fixed bag of unlimited run added screen . ... added new screen, restart now can operate at any moment . add) . ... added screens . Note: See TracRevisionLog for help on using the revision log. ...

Еще в разделе: (Показать все результаты (>24) - kodomo.cmm.msu.su/ )

• snakes (log) тАУ Python Battle

Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

... 101 / n° 9 / 1992 SHORT COMMUNICATIO N 0037-9646 / 92 / $ 2.00 + 0.00 © 19g2 Comit e va n Beheer va n het Bulletin v.z.w. p -AMPHOTERI C HETEROCYCLES Eugeny V. Babaev Chemical Department, State University Moscow, 119899, Russia Received : 24/08/1992 - Accepte d : 08/09/1992 The formation of the Wheland or Meisenheimer cr-complexes - the wellknown phenomena in chemistry of aromatics and heteroaromatics [1 , 2] - is a key step in the both classical SE2Ar and SN2Ar substitution. ... Chem. ...

Еще в разделе: (Показать все результаты (>147) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/040e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/049e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/085e.pdf