... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>4) - www.paleopedology.msu.ru/ )

... The system is organized as a mixture of two methods: concatenation - on the segment level (using the linguistically motivated units - allophones spliced together to form the synthesized speech wave) and the rule-based method on the prosodic level to modify speech wave created from the allophones according to the prosodic characteristics of the phrase being synthesized. ... Our system takes as an input text any sequence of orthographic words separated by gaps or punctuation marks. ...

Еще в разделе: (Показать все результаты (>348) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/web_1.doc
• http://www.philol.msu.ru/~otipl/new/main/courses/syntax_rus/fowler.pdf
• http://www.philol.msu.ru/~otipl/new/fdsl/abstracts/bylinina.pdf

New GCVS Version (GCVS5) FileName Explanations ----------------------------------------------------------------- ReadMe This file GCVS5 The ... ------------------------------------------------------ 1- 2 I2 --- Constell [1/88]Constellation numeric code 3- 6 I4 --- Number Star number within the constellation 7 A1 --- Component *Component identification 9- 18 A10 --- GCVS * Variable ... Field is non-blank if magMin is a magnitude or amplitude given in a system other than that indicated by magCode. ...

Еще в разделе: (Показать все результаты (>99) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Vols I-III (the new electronic version).

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>29) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/survey.pdf
• http://www.innovation.msu.ru/english/neuromotioncasestudy.doc
• Start-Up Company Development :: Управление инновационной политики и организации

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>52) - brain.bio.msu.ru/ )

... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, room 581 (Head of the laboratory) . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... Running specialised computer modelling and simulation, high-qualification and certification courses targeted at the engineers of the leading Russian industry. ...

Еще в разделе: (Показать все результаты (>261) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics
• Open Laboratory of Information Technologies | CMC MSU
• Open Laboratory of Information Technologies

. Strict Standards : Only variables should be assigned by reference in /storage0/www/http/fengoffice/environment/classes/debug/BenchmarkTimer.class.php on line 273 . Strict Standards : Only variables should be assigned by reference in /storage0/www/http/fengoffice/environment/classes/debug/BenchmarkTimer.class.php on line 297 . Забыли пароль . E-mail адрес: . Выслать пароль ( Вход ) .

Еще в разделе: (Показать все результаты (>2) - aesc.msu.ru/ )

Vol 444|30 November 2006 NEWS & VIEWS ARCHAEOLOGY High tech from Ancient Greece FranГois Charette The Antikythera Mechanism, salvaged 100 years ago from an ancient shipwreck, was long known to be some sort of mechanical calendar. ... LIBRARY, LEIDEN STEM-CELL BIOLOGY A move in the right direction Jeffrey S. Chamberlain Stem-cell therapy is valued for its potential to restore damaged or degenerating tissues. ... Although a variety of stem-cell types can become muscle cells when injected into the ...

Еще в разделе: (Показать все результаты (>86) - hbar.phys.msu.ru/ )

... What does people think about in my country? ... Some Situations are roots in communism, other are new situations created after 1990. ... In this very moment we have many private schools initiated and supported by many different ONG's. Changing the character of education . ... In Romania we need a different education system, one that is supported by society. ... The ramifications of educations system, based on the needs and the development of the economy as well as social and cultural life, go on. ...

Еще в разделе: (Показать все результаты (>161) - www.prof.msu.ru/ )

• Course Development Competition
• Eleven years of independence
• American Center Moscow- November 2006

... Business Address: Quantum Electronics Division, Physics Department, Moscow State University, Moscow 119992, Russia . ... 7 495 9393669 . Fax: +7 495 9391104 . ... Education: M.S., Physics, Moscow State University, 2003, with honor . Diploma work: Second harmonic generation by multiple quantum wells silicon/ oxide of silicon . ... Nonlinear optics and microscopic properties of multiple quantum wells Awards: "Grant of Moscow" for the best students in Physics (2002) . ... Phys. B 74, 671 (2002). ...

Еще в разделе: (Показать все результаты (>40) - shg.phys.msu.ru/ )

... About lab . ... Selected publications . Publications . ... Conference "GraphiCon" . Online Journal "Computer graphics and multimedia" (in russian) . ... Automatic building texture completion . Publication Type . Conference Paper . Year of Publication . ... Conference Name . ... Publication Language . ... http://graphics.cs.msu.ru/en/publications/text/gc2006kv.pdf . ...

Еще в разделе: (Показать все результаты (>176) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• Point Cloud Classification | Graphics and Media Lab
• High quality stereo-to-multiview generation | Graphics and Media Lab

setup-gsi: Configuring GSI security Installing /etc/grid-security/certificates//grid-security.conf.42864e48.. Running grid-security-config.. G S I : C O N F I G U R A T I O N P R O C E D U R E Before you use the Grid Security Infrastructure, you should first define the DN (distinguished name) that should be used for your organization's X509 certificates. ... Installing Globus CA signing policy into trusted CA certificate directory... setup-gsi: Complete ...

Еще в разделе: (Показать все результаты (>11) - lhe.sinp.msu.ru/ )

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>3305) - hist.msu.ru/ )

• Centralized Resource Allocation in the Soviet Economy in the 1930's

... CON entries in file 'embl.con' do not contain sequence data per se. ... File Number File Name Description Number of Records 1 CRC.TXT Checksum CRC uncompressed files 278 2 CRC_GZ.TXT Checksum CRC compressed files 278 3 DELETEAC.TXT Deleted accession numbers 187325 4 EMBL .CON Constructed Sequences 13437 5 FTABLE.TXT Feature Table Documentation 474 6 RELNOTES.TXT Release Notes (this document) 1327 7 SUBINFO.TXT Data Submission Documentation 390 8 UPDATE.TXT ...

Еще в разделе: (Показать все результаты (>196) - www.genebee.msu.ru/ )

• http://www.genebee.msu.ru/embl.html
• BLAST Basic Overview
• Tumor necrosis factor (TNF) is an inflammatory cytokine that can induce cells

. Deprecated : mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Warning : mysql_connect(): Can't assign requested address in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Can't assign requested address

77. http://www.mgumus.chem.msu.ru/publication/2008/2008-gaspar-multiple.pdf

78. Far-Eastern grey voles (Rodentia: Cricetidae: Alexandromys) from Bolshoi

79. http://acat02.sinp.msu.ru/topics.html

80. http://www.mse-msu.ru/IV_GMM_Program%20Peracchi.pdf