... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After · · 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues · Learn to write a CV and participate in an interview · Revise their reading strategies · Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>14) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf

... Terenin IM, Dmitriev SE, Andreev DE, Shatsky IN. 2008) Eukaryotic translation initiation machinery can operate in a bacterial-like mode without eIF2. Nat Struct Mol Biol . ... PubMed ][ PDF ] . ... 2007) Efficient translation initiation directed by the 900-nucleotide-long and GC-rich 5' untranslated region of the human retrotransposon LINE-1 mRNA is strictly cap dependent rather than internal ribosome entry site mediated. ... 2001) Molecular mechanisms of translation initiation in eukaryotes. ...

Еще в разделе: (Показать все результаты (>204) - www.genebee.msu.ru/ )

• Picornaviruses: discovering big in small
• GEA :: Gene Expression Analysis
• Laboratory of protein synthesis regulation

Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...

Еще в разделе: (Показать все результаты (>134) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf
• http://qfthep.sinp.msu.ru/talks2011/APopov_doklad.pdf
• http://qfthep.sinp.msu.ru/talks/Bunichev_singletop_tWb_LHC.pdf

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>129) - www.msm.biophys.msu.ru/ )

... Next: Image formation and processing Up: SPM Installation Previous: Server Contents Index . Figure 1.5: Client software part user interface. Client software part is a program, with which user work. ... All scanning parameters, that were defined by user, are transferred to the server and then to a microscope and to other users, connected as clients. ... At the same time user can process the data acquired using wide range of different functions, included in the program. ... File saving . ...

Еще в разделе: (Показать все результаты (>90) - www.spm.genebee.msu.ru/ )

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>39) - shamolin2.imec.msu.ru/ )

• Mathematical Reviews
• Maxim V. Shamolin Home Page

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>212) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis
• Publications about flora
• New Page 1

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>68) - hpc.msu.ru/ )

• MSU's HPC HISTORY | Moscow University Supercomputing Center
• Welcome to HPC.MSU.RU! | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>57) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

... Многие пользователи считают, что Интернет и World Wide Web (WWW, или Всемирная Паутина) - синонимы. ... Таким образом, World Wide Web - лишь один из сервисов Интернета. ... Среди них наиболее важными для пользователей WWW являются протоколы TCP/IP (Transmission Control Protocol/Internet Protocol) и HTTP (HyperText Transfer Protocol). ... Наиболее популярны в настоящее время браузеры Microsoft Internet Explorer и Netscape Communicator (более ранние версии - Netscape Navigator). ...

Еще в разделе: (Показать все результаты (>309) - www.nature.web.ru/ )

• Протеолитический процессинг у синдбис-подобных вирусов
• Инициация трансляции у эукариот

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>9) - bioinf.fbb.msu.ru/ )

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>3) - cellbiol.genebee.msu.ru/ )

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>80) - selena.sai.msu.ru/ )

• Родионова Жанна Федоровна
• Yurii Naumovich Lipsky

... Payment is made at transfer of means for the University account All expenses of transferring the money to the University account are beard by the Student. In the event the Student is expelled by the University for the lack of academic progress; transgression of the sections stated in Article 3; for the Student's own personal reasons; for medical reasons confirmed by the official medical paper, all payments made are non-refundable. Article 2 Obligation and rights of the University 2.1. ...

Еще в разделе: (Показать все результаты (>32) - foroff.phys.msu.ru/ )

• Admission Regulation
• The Faculty System of Education
• Key research directions

... Chandra Observation of LMXB in M84 . We present characteristics of the X-ray point source population in the M84 field as observed by Chandra ACIS-S. We find the galactic sources in M84 follow the stellar light profile, which imposes similar formation histories for stars in both single and binary systems. After correcting for incompleteness in the source detection, we find a log N-log S similar to that of the elliptical galaxy NGC4697. ...

Еще в разделе: (Показать все результаты (>235) - xray.sai.msu.ru/ )

• Case B: #tex2html_wrap_inline768#
• Wolf-Rayet and He stars (stage IV)
• Константин Александрович Постнов

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>155) - nuclphys.sinp.msu.ru/ )

• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение расстояния между источником и детектором
• Определение толщины пластин

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>166) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/talks/2014sanya-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2013mexico-talk.pdf

NAME httpd - Apache hypertext transfer protocol server SYNOPSIS httpd [ - X ] [ - R libexecdir ] [ - d serverroot ] [ - f config ] [ - C directive ] [ - c directive ] [ - D parameter ] httpd [ - h ] [ - l ] [ - L ] [ - v ] [ - V ] [ - S ] [ - t ] [ - T ] DESCRIPTION httpd is the Apache HyperText Transfer Protocol (HTTP) server program. ... This manual page only lists the command line arguments. ... Paths in this manual may not reflect those compiled into httpd. ... The default is /usr/local/apache . ...

Еще в разделе: (Показать все результаты (>60) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache modules
• Apache module mod_dir

... ОБЩИЕ СВЕДЕНИЯ О СЕТИ ИНТЕРНЕТ . ... Краткая история развития сети . История Интернет уходит своими корнями в ранний период развития компьютеров и компьютерных сетей. ... Осуществление таких жестких требований на практике стало возможным только путем использования уже существовавших компьютерных сетей. ... Но в сети Интернет возможно осуществить и более сложный режим пересылки информации с удаленного компьютера, получивший название протокола FTP (File Transfer Protocol). ...

Еще в разделе: (Показать все результаты (>20) - heritage.sai.msu.ru/ )