Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>1737) - istina.msu.ru/ )

• Mayer-Wolf E. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Bogolitsyn K.G. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Varnek Alexandre - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>10) - hcs.cmc.msu.ru/ )

• Master program "Open Information Systems" | Магистерское и послевузовское

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>10) - physcontrol.phys.msu.ru/ )

• List All Categories

... Strike-slip magmatic duplexes . ... During 1996-1998 we have carried out a complex field and laboratory study of particular class of the geological objects, which we named strike-slip magmatic duplexes (SSMD), in limits of the Eastern Urals, Central Kazakhstan and Kola-Karelia region. ... 2) We recovered within the Eastern Urals a series of geological objects identidied as SSMD of different age and of different deepness, and studied them in detail due to field investigations. ...

Еще в разделе: (Показать все результаты (>11) - sbmg.geol.msu.ru/ )

COBORDISMS AND FINITE GROUP ACTIONS IN THE WORK OF TARAS PANOV In works of T. Panov [5]­[7] the cobordism theory and formal group laws are applied to the study of the fixed point sets of Z/p-actions. Characteristic classes and cob ordisms of manifolds with simple Z/p-action. A Z/p-action on a manifold M is called simple if all connected components of the fixed point set have trivial normal bundle. ... El liptic genus for manifolds with an action of the group Z/p. Russian Math. ...

Еще в разделе: (Показать все результаты (>151) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2011/Bozhenko-et-al-1101.2576v1.pdf
• Alexey Garber
• Topology section

... Форумы > Аспирантура > Тема . ... Аспирантура в Англии по машинному обучению . Если Вас интересует аспирантура в Англии по теме 'Машинное обучение' (с большим весом математических методов: функциональный анализ, теория вероятностей,...), пожалуйста свяжитесь со мной: vovk@cs.rhul.ac.uk (Владимир Вовк). ... Название проекта, в рамках которого ищется аспирант, - 'Practical competitive prediction' (funded by EPSRC). ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>136) - www.mmonline.ru/ )

• Эволюция Программиста

... Полная версия этой страницы: Продам велик Merida Matts Sport 500 . Студенческий форум Физфака МГУ > Общий > Все обо всем > Объявления . ... BR> <BR>(цвет только не такой; на фотку моего велика можно глянуть тут )<BR><BR> . ... tbody><tr bgcolor="#d7d7d7"><td nowrap="nowrap" valign="top"><b class="tech">РАМА:</b></td><td valign="top">MERIDA, MATTS SPORT DISC FRAME</td></tr> . ... Merida Matts Comp или Merida Matts Mission (Disk) (или даже GT Avalanche 0.5). ...

Еще в разделе: (Показать все результаты (>281) - wasp.phys.msu.ru/ )

• Продам велик Merida Matts Sport 500 - Студенческий форум Физфака МГУ

Lo cal combinatorial formulae for the Pontryagin classes of triangulated manifolds Alexander A. Gaifullin Moscow State University, Faculty of Mechanics and Mathematics, Department of Geometry and Topology, Moscow, 119992, Russia e-mail: gaifull@mccme.ru The talk will be devoted to the problem of computing the rational Pontryagin classes of a triangulated manifold from a local structure of the triangulation. ...

Еще в разделе: (Показать все результаты (>24) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/IlyinMoiseev.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/VasilievaButuzovNefedov.pdf

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4912) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF
• CDFE provides the major photonuclear databases. Online Services.
• Wave Function Value Database

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... All Journals . This list contains all journals in JCatalog database. Select the letter and click it. If there is no action when clicking then no journals begins from this letter. Set the mouse cursor on any letter and you will know the number of journals; gray letter colour means that no journals begins from it. ... View whole journal list(1749) . ... Index | All journals . ...

Еще в разделе: (Показать все результаты (>15) - journals.genebee.msu.ru/ )

... Natalya V. Raguzova and Sergei B. Popov . ... We present a compilative catalogue of Be/X-ray binaries and candidates in the Galaxy and in the Large and Small Magellanic Clouds. This catalogue contains 160 sources and provides information on names and spectral types of optical components, distances, on spin characteristics of neutron stars, and on orbital and X-ray properties of binary systems. ... Be/X-Ray Binaries and candidates in the Galaxy . Galactic sources: comments to the Table 1 . ...

Еще в разделе: (Показать все результаты (>520) - xray.sai.msu.ru/ )

• Massive X-ray Binaries
• PSR B0042-73 in the Small Magellanic Cloud
• Links to Databases

... The system is organized as a mixture of two methods: concatenation - on the segment level (using the linguistically motivated units - allophones spliced together to form the synthesized speech wave) and the rule-based method on the prosodic level to modify speech wave created from the allophones according to the prosodic characteristics of the phrase being synthesized. ... Our system takes as an input text any sequence of orthographic words separated by gaps or punctuation marks. ...

Еще в разделе: (Показать все результаты (>309) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/web_1.doc
• http://www.philol.msu.ru/~otipl/new/mscl/2008/abstracts/miteva.pdf
• http://www.philol.msu.ru/~otipl/new/mscl/2008/abstracts/kimmelman.pdf

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>60) - erg.biophys.msu.ru/ )

• pymol ERG Research Group: Лаборатория теоретической биофизики
• Nanotubes generating script for PyMol ERG Research Group: Лаборатория
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория

... Academic Departments . ... Partners . ... All partners . ... 22.09.2015 On September, 17 the first masterclass organized by prominent Russian media company Mail.Ru Group took place at the Faculty of Journalism. ...

Еще в разделе: (Показать все результаты (>65) - www.journ.msu.ru/ )

• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span

.

Еще в разделе: (Показать все результаты (>19) - www.chemport.ru/ )

• Diy store chains of russia analytic database маркетинговое исследование рынка

The Department of Talented Youth Affairs and Professional Orientation . ... Olympiads . ... All-army olimpiad . ... Olympiad for School Pupils . ... Olympiad for school pupils was held in 2005 under the motto ?Via scientiarum?, which means ?The way to the knowledge? in Latin. ... The 46 th Mendeleev International Olympiad in Chemistry for School Pupils was held in Kazakhstan in the 2011-2012 school year. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>36) - talant.msu.ru/ )

... Now let us consider that damping or amplitude of the signal like a natural index of a hypothetical inequality or mean between the action and reaction, or the kinetic and the potential energy of the system. The time between the action and the reaction must be different from zero. ... We can describe this behaviour in its simpler form by the oscillation of a balance with inertiality or sensitivity, that is to say, with a time of reaction for the operations of adding or removing weights. ...

Еще в разделе: (Показать все результаты (>382) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/biographies/bell_shulman.pdf
• Табл. 1. Характер лимитирования при потенциальном ограничении роста альгоценоза
• GENERATING FLOWS AND A SUBSTITUTIONAL MODEL OF SPACE-TIME

. Name . Last modified . Size . Description . Parent Directory . - . c/ . 14-Aug-2013 09:46 . - . fe/ . 06-Sep-2013 09:08 . - . he/ . 14-Aug-2013 07:49 . - . mg/ . 03-Sep-2013 14:32 . - . n/ . 15-Aug-2013 09:40 . - . ne/ . 03-Sep-2013 12:57 . - . o/ . 02-Sep-2013 15:13 . - . p/ . 31-Jul-2013 15:46 . - . s/ . 06-Sep-2013 07:40 . - . si/ . 05-Sep-2013 14:26 . - . Apache/2.2.16 (Debian) Server at swx.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>2355) - swx.sinp.msu.ru/ )

• Index of /models/database/db/010128
• Index of /models/database/db/010410
• Index of /models/database/db/001108

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out