... Main Discography . Studio Albums . ... CD Singles . ... Joe Satriani . ... The Essential Deep Purple Survival Kit . ... Deep Purple Tribute Albums . ... The Highway Star's Deep Purple Discography seeks to cover all, or at least most, official releases. ... Joe Cath <joecath(at)aol.com> . ... Rasmus Heide <rasmus(at)deep-purple.com> . ... Benny Holmstr?m <benny(at)deep-purple.com> . ... Ed Janx <edjanx(at)deep-purple.com> . ... Stathis Panagiotopoulos <span(at)deep-purple.com> . ... Deep Purple ! ...

Еще в разделе: (Показать все результаты (>6) - shamolin2.imec.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. Школа-конференция молодых ученых "Новые органические реакции и методологии зеленой химии" . Закрытие конференции проф. Cinzia Chiappe, проф. Teodor Ast, проф. Pietro Tundo, проф. Chieu D. Tran, проф. David Black. Поиск по серверу . Сервер создается при поддержке Российского фонда фундаментальных исследований . Не разрешается копирование материалов и размещение на других Web-сайтах . Вебдизайн: Copyright (C) И. Миняйлова и В. Миняйлов . Copyright (C) Химический факультет МГУ . Написать письмо редактору .

Еще в разделе: (Показать все результаты (>92) - chem.msu.ru/ )

• Friends

... The "SIAG/LA-SIMUMAT International Summer School on Numerical Linear Algebra" was organized by the SIAM Activity Group on Linear Algebra and was held at the International Center of Mathematical meetings (CIEM) in Castro Urdiales, July 21-25, 2008. Alexander Pozdneev, PhD student of the ASR Department, has attended the Summer School. ... SIAG/LA-SIMUMAT International Summer School on Numerical Linear Algebra (see section "LAST HOUR INFORMATION") . ...

Еще в разделе: (Показать все результаты (>28) - ani.cmc.msu.ru/ )

• Department of the Automation for Scientific Research CMC MSU | Computational

... The "SIAG/LA-SIMUMAT International Summer School on Numerical Linear Algebra" was organized by the SIAM Activity Group on Linear Algebra and was held at the International Center of Mathematical meetings (CIEM) in Castro Urdiales, July 21-25, 2008. Alexander Pozdneev, PhD student of the ASR Department, has attended the Summer School. ... SIAG/LA-SIMUMAT International Summer School on Numerical Linear Algebra (see section "LAST HOUR INFORMATION") . ...

Еще в разделе: (Показать все результаты (>16) - ani.cs.msu.su/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octoshell: Lightweight and Innovative Cluster Management System . ... CLEO: User&Admin-Friendly Cluster Batch System . ... Cleo is used on SKIF MSU тАЬCHEBYSHEVтАЭ cluster (5000 cores) and тАЬGraphIT!тАЭ (192 CPU cores + 48 . GPUs) supercomputers of Moscow State University . ... Research Computing Center (RCC) of Lomonosov Moscow State University . Supercomputing Consortium of Russian Universities . ...

Еще в разделе: (Показать все результаты (>64) - hpc.msu.ru/ )

... Prions and chaperones: friends or foes? ... This review highlights the modern perception of anomalous folding of the prion protein and the role of chaperones therein. Special attention is paid to prion proteins from mammalian species, which are prone to amyloid-like prion diseases due to a unique aggregation pathway. ... The most interesting of those are connected to the interaction with chaperone system, which is responsible for stabilizing protein structure and disrupting aggregates. ...

Еще в разделе: (Показать все результаты (>5) - biochem.bio.msu.ru/ )

... Vector Processors: Historical Perspectives . ... The first vector machines were the CDC STAR-100 and the TI ASC, both announced in 1972.Both were memory-memory vector machines. ... Convex started with a uni-processor vector machine (C-1) and now offers a small multiprocessor (C-2); they emphasize Cray software capability. Alliant has concentrated more on the multiprocessor aspects; they build an 8-processor machine, with each processor offering vector capability. ... Центры . ...

Еще в разделе: (Показать все результаты (>143) - www.parallel.ru/ )

• Bibliography | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Request_free | PARALLEL.RU - Информационно-аналитический центр по

Business English Certificate), ICM (The Institute of Commercial Management) Diploma In Business English, LCCI (The London Chamber of Commerce and Industry) English for Business. 1 . ... P.Strutt, Longman Business English Usage, p. 6-9, 31. ... Leo Jones, Richard Alexander, New International Business English, Cambridge University Press, 1996. ... Andrew Littlejohn, Company to Company, A new approach to business correspondence in English, Cambridge University Press, 1998. ...

Еще в разделе: (Показать все результаты (>63) - ffl.msu.ru/ )

• Наш факультет

Vespertilio 17: 127­128, 2014 ISSN 1213-6123 New records of the bat fly Basilia mongolensis in the mountains of Asia (Diptera) Maria V. o rlova & Alexandr V. Z higalin National Research Tomsk State University, 36, Lenina str., ... In total, 12 specimens were collected from five individuals of the David's Myotis Myotis davidii (Peters, 1869). These findings specify the range of this poorly known bat ectoparasite species in Central Asia and southern Siberia (the northern margin of its distribution). ...

Еще в разделе: (Показать все результаты (>291) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• Types Database

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... 08.01.2015 Professors and students of the Faculty of Journalism express their deep condolences to families and friends of journalists of Charlie Hebdo shot in Paris January, 7, 2015. 29.12.2014 The Faculty of Journalism, Lomonosov Moscow State University wishes you a Merry Christmas and a very happy New Year! ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>10) - www.journ.msu.ru/ )

• Happy Tatiana Day! :: Department of Journalism, M. V. Lomonosov Moscow State

MGU Botanic Garden . ... The MSU Botanical Garden is not only a valuable scientific institution, but also a place giving joy and a good mood to many people. ... To become a volunteer, please, fill in the application e-form and send it to the following e-mail address: . ... We will contact you on your telephone number within a week of your sending the application. Community work days are also held on the territory of the Garden for different organization and agency workers. ...

Еще в разделе: (Показать все результаты (>3) - botsad.msu.ru/ )

. My present-day life in photos . Carnivals . I like to visit the region . where I was born . Museums . Our picnics in Moscow Region . My lectures . Scientific events . Photo portraits . Walks in forest . My colleagues and friends . With Prof. M.Feigenbaum . My hobby . My friend Andrei Isaev . Dacha of Vadim Anischenko, Volga river . With Vered Rom-Kedar, Israel . My friends abroad . With Kolya Brilliantov, . my friend

Еще в разделе: (Показать все результаты (>23) - chaos.phys.msu.ru/ )

• Links

... A library of contemporary psychological literature in foreign languages is open at the Psychological Faculty of Lomonosov Moscow State University. ... The library was founded by Vyacheslav Viktorovich Luchkov (1941 - 1997) . ... When Vyacheslav Luchkov untimely deceased in 1997 Dulce Murphy, Chief Executive Officer of the Russian-American Center under Esalen Institute (California) suggested renaming the library into the Library in the name of Vyacheslav Luchkov. ... Library premises . ...

Еще в разделе: (Показать все результаты (>91) - www.psy.msu.ru/ )

Class of attribute sets, designed for parsing and storing attribute values from a TWiki tag e.g. %TAG{"joe" fred="bad" joe="mad"}% . ... The default parameter (unnamed quoted string) is named _DEFAULT in the hash. ... As well as the default TWiki syntax (parameter values double-quoted) this class also parses single-quoted values, unquoted spaceless values, spaces around the =, and commas as well as spaces separating values. ... new ClassMethod new ($string,$friendly)=>\%attrsObjectRef . ...

Еще в разделе: (Показать все результаты (>18445) - dualopt1.cmm.msu.ru/ )

• TWikiAttrsDotPm - TWiki - TWiki
• %TOPICTITLE% (1 vs. 2) - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki