... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

e mail: level_s@rambler.ru) , , , , , , , , conflict theory, social order, functionalism, social integration, system integration, Talcott Parsons, Ralf Dahrendorf, John Rex, David Lockwood . ... The theory of the conflict proceeds from belief that society always contains fundamental conflicts of interest and that social order is achieved by balance of power in which the interests of the stronger successfully contain and channel the demands of the weaker. ...

Еще в разделе: (Показать все результаты (>2) - vestnik.socio.msu.ru/ )

Homepage: http://desandro.com/resources/jquery-masonry . ... Masonry is a layout plugin for jQuery. ... Whereas floating arranges elements horizontally then vertically, Masonry arranges elements vertically then horizontally according to a grid. ... Depending on the layout, you?ll most likely need to specify one option. ... Lorem ipsum dolor sit amet, consectetuer adipiscing elit. ... This topic: System > JQueryPlugin > JQueryMasonry . ... Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>270) - wiki.cmc.msu.ru/ )

... Pleistocene soils older than Wisconsin Age are preserved only locally in the Driftless Area of Wisconsin, USA. ... Our longest known sequence is at Oil City, Wisconsin, were a 9 m section contains 5 loesses and 3 colluvial deposits with 5 buried soils; all are Except the mid-Wisconsin Farmdale soil, all of the buried soils at Oil City have argillic horizons and are intensely weathered. ... However, few buried soils have all genetic horizons preserved. ... Back to the Abstracts list ...

Еще в разделе: (Показать все результаты (>15) - www.fadr.msu.ru/ )

... Клуб выпускников / Члены клуба / Результаты поиска . клуб выпускников члены клуба вступить в клуб доска объявлений наши партнеры . Найдено 2636 записей, удовлетворяющих условиям поиска: . ... Loginova (Kalinina) Anna Borisovna . ... Pidpalaya Alexandra Alexandrovna . ... Pykhova Elena Leonidovna . ... Rimashevskaya Marianna Alexandrovna . ... Smoljakova Elena Kirillovna . ... Syrnikova Anna Nikolaevna . ... Volgemut (Pikina) Elena Evgenievna . ... 2636. ...

Еще в разделе: (Показать все результаты (>2) - www.guru.ru/ )

. Клуб выпускников МГУ (Московский Государственный Университет) . Большая проблема Канады - это дикие гуси. Они портят поля для гольфа, выщипывают траву, портят имущество, да вообще летают сотнями и делают что хотят. Дэвид Маркс (David Marcks) 20 лет занимался проблемой гусей и очень неплохо преуспел в этом. Добавить сообщение . Страница сайта http://www.moscowuniversityclub.ru . Оригинал находится по адресу http://www.moscowuniversityclub.ru/services/messages.asp?forumId=0 =5871 .

Еще в разделе: (Показать все результаты (>253) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Новости США и Канады
• Клуб выпускников МГУ: Ученые: Алкоголь вреднее экстази и ЛСД
• Клуб выпускников МГУ: Ученые нашли ключ к молодости кожи

VIII Fulbright Summer School in the Humanities America Virtual and Imaginary Tver, June 20 - 26, 2005 June 20, Monday 16.00 Opening 16.30 N. Katherine Hayles (UCLA) Culture and Technology: Where Are We Headed? A lecture) June 21, Tuesday 10.00 - 11.30 N. Katherine Hayles Virtual and Imaginary: Societies in the Computational World. ... Conflict in History: Interpretation and Ideology June 22, Wednesday 10.00 - 11.30 N. Katherine Hayles Virtual and Imaginary: Societies in the Computational World. ...

Еще в разделе: (Показать все результаты (>75) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~rkigf/P_Objavlenija/Konferencii/Konferencii_2009/2009_9_Ostrava_CZ-INFO-letacek-COK4.pdf
• http://www.philol.msu.ru/~rkigf/P_Objavlenija/Konferencii/Konferencii_2009/2009_9_Ostrava_ENG-info-poster-COK4.pdf
• Люди ОТиПЛа. М. А. Даниэль :: МГУ :: Филфак :: ОТиПЛ

Title Author Key words Theories of social mobility in the history of sociological thought Baturenko S.A. theories of social mobility, social stratification, Karl Marx, Pitirim Sorokin, Reinhard Bendix, Seymour Martin Lipset, David Glass In this article evolution of theories of social mobility in the history of social thought from the classical period of development until the end of the XX century is analyzed. ...

Еще в разделе: (Показать все результаты (>2) - www.socio.msu.ru/ )

... Vector Processors: Historical Perspectives . ... The first vector machines were the CDC STAR-100 and the TI ASC, both announced in 1972.Both were memory-memory vector machines. ... Convex started with a uni-processor vector machine (C-1) and now offers a small multiprocessor (C-2); they emphasize Cray software capability. Alliant has concentrated more on the multiprocessor aspects; they build an 8-processor machine, with each processor offering vector capability. ... Центры . ...

Еще в разделе: (Показать все результаты (>50) - www.parallel.ru/ )

• Bibliography | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI: Message Passing Interface - русскоязычная страница | PARALLEL.RU -

Vespertilio 17: 127­128, 2014 ISSN 1213-6123 New records of the bat fly Basilia mongolensis in the mountains of Asia (Diptera) Maria V. o rlova & Alexandr V. Z higalin National Research Tomsk State University, 36, Lenina str., ... In total, 12 specimens were collected from five individuals of the David's Myotis Myotis davidii (Peters, 1869). These findings specify the range of this poorly known bat ectoparasite species in Central Asia and southern Siberia (the northern margin of its distribution). ...

Еще в разделе: (Показать все результаты (>146) - zmmu.msu.ru/ )

• Types Database

... class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 7 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p2 # , p1 def proximity(self, p1, p2): # in bool # self.edges[p1] p2 return p2 in self.edges[p1] 3.1.1.2. . class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p # , p def neighborhood(self, p): return self.edges[p] . ...

Еще в разделе: (Показать все результаты (>3) - compmech.math.msu.su/ )

... Parent Directory - affreschi di michelangelo 1.JPG 01-Dec-2012 15:08 1.2M affreschi di michelangelo 2.JPG 04-Dec-2012 00:00 1.5M arno.JPG 01-Dec-2012 13:00 1.1M david.JPG 03-Dec-2012 23:52 1.4M duomo 1.JPG 03-Dec-2012 23:52 1.5M duomo 2.JPG 03-Dec-2012 23:52 1.4M duomo 3.JPG 03-Dec-2012 23:59 2.0M firenze 1.JPG 01-Dec-2012 13:17 1.4M firenze 2.JPG 01-Dec-2012 13:17 1.3M firenze 3.JPG 01-Dec-2012 12:25 ...

Еще в разделе: (Показать все результаты (>9) - higeom.math.msu.su/ )

... 2 · ­ , , · ­ · ­ , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>2) - lvk.cs.msu.su/ )

... Faculty of Physics . M.V.Lomonosov Moscow State University . ... Source: Server administrator . ... M.V.Lomonosov Moscow state University announced a competition for the schoolboys within the frame of the project targeted at launching a sputnik by the university by the 250th jubilee of Moscow state. ... Conference web-site . ... 01.05.2003 New web-site . A new web-site of the Faculty of Physics, which has both a new structure and graphics design, has been launched to the test exploitation. ...

Еще в разделе: (Показать все результаты (>26) - phys.msu.ru/ )

• Нобелевская премия по физике за 2004 г.
• Новости
• Физический факультет МГУ им. М. В. Ломоносова

... Введение в разработку компьютерных игр . ... В частности, в курсе рассматриваются основные понятия и элементы разработки компьютерных игр как с точки зрения разработки программного обеспечения, так и с точки зрения создания дизайна игры. Вопросы, освещаемые в части курса, посвященной дизайну компьютерных игр . ... Введение в курс лекций, отличие компьютерных игр от обычных приложений . ... История игровой индустрии и компьютерных игр . ... Лекция ?3 (введение в дизайн компьютерных игр - Нивал) . ...

Еще в разделе: (Показать все результаты (>30) - oit.cmc.msu.ru/ )

... Alexei Zheltikov, Lomonosov Moscow State Univ., Russia . Members . Eugene Baklanov, Inst. of Laser Physics, Russia . ... Mikhail Fedorov, Prokhorov General Physics Inst., ... Viktor Veselago, A.M.Prokhorov General Physics Inst., ... Petr Obraztsov, Prokhorov General Physics Inst., ... Boris Denker, Prokhorov General Physics Inst., ... Galina Bufetova, Prokhorov General Physics Inst., ... Andrey Kurkov, Prokhorov General Physics Inst., ... Vladimir Tsvetkov, Prokhorov General Physics Inst., ...

Еще в разделе: (Показать все результаты (>3) - iconolat13.phys.msu.ru/ )

• Invited speakers

... Доцент . ... Роль новых информационных технологий в обучении иностранным языкам . Кабардино-Балкарский государственный университет, кафедра английского языка. ... МГУ, Центр международного образования, кафедра русского языка для иностранцев. ... Global Understanding - проект по межкультурному общению на факультете иностранных языков и регионоведения МГУ . ФИЯР МГУ. ... Факультет иностранных языков и регионоведения МГУ, доцент . ... МГУ, факультет иностранных языков и регионоведения, доцент . ...

Еще в разделе: (Показать все результаты (>5) - anazarenko.ffl.msu.ru/ )

TWiki (TM) was written by Peter Thoeny, based on parts of Ward Cunningham's original Wiki and Jos Wiki, and has been further developed by Peter and other TWiki contributors. ... This document identifies these people as authors of TWiki. ... TWiki:Main.AdamTheo | USA | ... TWiki:Main.AdrianLynch | Australia | ... TWiki:Main.AlWilliams | ... Russia | ... Italy | ... Germany | ... Canada | ... Brazil | ... http://c-dot.co.uk | ... Markus Peter | ... http://www.structuredwikis.com/peter | ...

Еще в разделе: (Показать все результаты (>59) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (10 vs. 11) - TWiki
• %TOPICTITLE% (12 vs. 13) - TWiki
• TWikiContributor - TWiki - TWiki

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

80. Официальный сайт механико-математического факультета МГУ имени М.В.Ломоносова