Studying at MU Programs and degrees . ... Moscow State University provides a wide range educational services and educational programmes. ... International students are offered Bachelour (4 years full time) and Master programmes (2 years full time). A number of our faculties train both domestic and international students according to Bachelour and Master programmes with granting Bachelour and Master diplomas. ... Please, contact International Students Office for information on the topics offered. ...

Еще в разделе: (Показать все результаты (>188) - www.ied.msu.ru/ )

... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>12) - en.fbb.msu.ru/ )

... Data and place of birth: . ... Excitation of nuclear and hadron degree of freedom in hadron-nucleus interaction . ... Participation in experiments: . The theoretical calculation and the analysis of data in experiment of ITEP (Moscow,1972-1978) on the Rho-meson production by pions at 3.72 Gev/c on nuclear target . ... The analysis of data in SMS MSU experiment (Dubna, 1985-1990) devoted to the space-time structure of hadron interaction in proton- nucleus collisions at 9 GeV/c (JINR accelerator) . ...

Еще в разделе: (Показать все результаты (>145) - lav01.sinp.msu.ru/ )

• Vladimir L. Korotkikh
• Home Page of A. Snigirev

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>5) - physcontrol.phys.msu.ru/ )

Moscow State University . Physics Department . ... Home :: History of Research :: History of Research in Polymer Physics at the Physics Department of Moscow State University . ... Studies in polymer theory were initiated at the Physics Department of Moscow State University by Professor I.M.Lifshitz (1917-1982). ... A.Yu.Grosberg, I.Ya.Erukhimovich and A.R.Khokhlov were among his first students. ... Grosberg, A.R. Khokhlov. ... Statistical Theory of Polymeric Lyotropic Liquid Crystals. ...

Еще в разделе: (Показать все результаты (>556) - polly.phys.msu.ru/ )

• International Workshop "Theory and Computer Simulation of Polymers: New
• Personnel - Chair of Polymer and Crystal Physics
• Practicums - Chair of Polymer and Crystal Physics

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>3) - oc.cs.msu.su/ )

General Theory, Mathematics, Numerical Methods of Nonlinear Acoustics . ... Advances in Theoretical Nonlinear Acoustics . ... O.A.Sapozhnikov, V.A.Khokhlova, A.A.Slavnov (Department of Acoustics, Faculty of Physics, Moscow State University, Moscow, Russia) . ... N.S.Bakhvalov (Faculty of Mechanics and Mathematics, Moscow State University, Moscow, Russia); J.I.Osypik, N.I.Pushkina, Ya.M.Zhileikin (Research Computing Center, Moscow State University, Moscow, Russia) . ...

Еще в разделе: (Показать все результаты (>890) - acs366.phys.msu.su/ )

• Abstract
• Nonlinear Acoustics of the Atmosphere, the Ocean, and the Earth
• Nonlinear Acoustics in Solid State Physics

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>2) - cytol.bio.msu.ru/ )

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>197) - srcc.msu.ru/ )

• История НИВЦ
• Laboratory of Systems for Automated Image Processing
• Leading scientific fellow Sergey Piskarev Ph.D.

Lomonosov project . ... Personnel . Mikhail Lomonosov . ... Affiliation D.V. Skobeltsyn Institute of Nuclear Physics of M.V. Lomonosov Moscow State University . ... Email panasyuk sinp msu ru . Phone 7 495 939 1818 . ... Phone 7 495 939 5731 . ... Phone 7 495 939 1010 . Fax 7 495 939 0896 . ... Phone 7 495 939 5063, 7 916 909 5892 . Fax 7 495 939 5063 . ... Phone 7 495 939 5734 . Fax 7 495 939 1158 . ... Phone 7 495 939 4496 . ... Phone 7 495 939 5160 . ... Phone 7 495 939 5088 . ...

Еще в разделе: (Показать все результаты (>54) - lomonosov.sinp.msu.ru/ )

... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.  ... Especially in Russia women received possibility of professional realization in chemical science and education through  different ways starting from 1870’s on. ...

Еще в разделе: (Показать все результаты (>183) - www.chem.msu.ru/ )

• Dmitriy Mendeleev Online

... The Linnaean Collection of the Herbarium of Moscow State University: digital images, comments, historical review. ... Eight bonus high quality images of 700 ppi resolution. ...

Еще в разделе: (Показать все результаты (>2351) - herba.msu.ru/ )

• Moscow State University, Geobotany dpt. - Registration
• The Linnaean Collection of the Herbarium of Moscow State University
• Moscow State University, Geobotany dpt. - Login

LOMONOSOV MOSCOW STATE UNIVERSITY DEPARTMENT OF PSYCHOLOGY Russian Federation, Moscow, Mokhov aya str., h.11 b.5, 125009 Phone: +7(495) 6295782 You are welcome to take part into XVIII International Scientific Conference for Undergraduate and Postgraduate Students and Young Scientists "LOMONOSOV" Section: Psychology 11-15 April, 2011 Psychology Today: Traditions and Innovations Subject of subsections and group discussions: 1. Methodological Problems of Modern Psychology; 2. ...

Еще в разделе: (Показать все результаты (>236) - www.psy.msu.ru/ )

• Faculty of psychology Lomonosov Moscow State University
• Psychology in Russia. State of the Art. Editorial Board
• Psychology in Russia: State of the Art, Vol. 2, 2009

... ACAT'2003 : IX INTERNATIONAL WORKSHOP ON ADVANCED COMPUTING AND ANALYSIS TECHNIQUES IN PHYSICS RESEARCH (ACAT03), 1-5 December, 2003, Tsukuba, Japan. ... Advanced Statistical Methods for Data Analysis Traditionally, researchers from high energy and nuclear physics together with experts in computer science take part in the ACAT series of workshops. ... Thus, researchers from these and other fields are welcome to join us in discussions on modern computing techniques and ways for new developments. ...

Еще в разделе: (Показать все результаты (>82) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/trav_info.html
• http://acat02.sinp.msu.ru/accomod.html
• http://acat02.sinp.msu.ru/InfoBull1.txt

... Sternberg Astronomical Institute, Moscow State University, Moscow Union "Optic" . ... Ural State University, Kourovka . ... Irkutsk State University . ... The 2 first images in different polarizatios (Eeast-telescope and West-telescope) . ... West Time GRB Mag Error (hour) 1.02097639 17.93 0.22 1.07643278 17.43 0.09 1.13188834 17.78 0.14 1.18734417 18.03 0.19 1.24280056 17.87 0.15 1.29825584 17.58 0.10 1.35371584 17.94 0.12 . ... GCN 10076) . ... GCN 10048) by internet 3422 s after the GRB time. ...

Еще в разделе: (Показать все результаты (>261) - observ.pereplet.ru/ )

• Обсерватория
• MASTER GLOBAL ROBOTIC TELESCOPES NET

Geology . Geophysics . Geochemistry . Hydrogeology and Engineering Geology . Combustible Fossils Geology and Geochemistry . Ecological Geology . Faculty of geology > English > Bachelour degree . ... Gravity Survey . Magnetic Survey . Seismic Survey . Electric Survey . ... 119899, Russia, Moscow, Leninskie gory, Moscow State University, Faculty of geology. Tel: (095) 939-2970 Fax: (095) 932-8889, E-mail: admin@geol.msu.ru . Faculty of geology, 2002 . ...

Еще в разделе: (Показать все результаты (>116) - www.geol.msu.ru/ )

• Faculty of Geology >> Geology at Moscow State University
• Faculty of Geology >> Departments
• Trofimov Victor Titovich

... Vladimir Ivanovich . ... M.V.Lomonosov Moscow State University, . 119991 Moscow, Russian Federation . ... Department of Chemical Enzymology, Faculty of Chemistry, M.V. Lomonosov Moscow State University, Moscow, Russian Federation . ... Faculty of Chemistry, M.V.Lomonosov Moscow State University, Moscow, Russian Federation . ... Professor, Head of the Laboratory of Genetic Engineering and Protein Design - Faculty of Chemistry , M.V.Lomonosov Moscow State University, Moscow, Russian Federation . ...

Еще в разделе: (Показать все результаты (>202) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology
• Research Group of Biochemistry of Fibrinolysis"
• Scientific cooperation

... Research . ... 1976 – current: Moscow State University . ... Moscow State Institute of Foreign Languages (currently - Moscow Linguistic University), Translation Faculty, Department of Machine Translation . ... Degree granted through Moscow State University, Department of Structural and Applied Linguistics, V.A.Zvegintsev, Head . ... Russian State Humanitary University, Department of General and Applied Linguistics. ... Moscow State Linguistic University, Department of General Linguistics. ...

Еще в разделе: (Показать все результаты (>40) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... About choir . ... Conductor . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Askerov Mirza-Aga Saftarovich , born in 1959, honored cultural worker of the Russian Federation, honored worked of the All-Russian Musical Society, candidate of pedagogical sciences. ... Since 1990 has been working with the Academic Choir of Moscow State University on the recommendation of professor V.V. Baranov, the honored cultural worker of the Russian Federation. ...

Еще в разделе: (Показать все результаты (>11) - new.choir.msu.ru/ )

• News | Academic choir of Moscow State University
• Galery | Academic choir of Moscow State University
• Contacts | Academic choir of Moscow State University