... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Nanoterrorism: New Responsibility for Our World and Future in the Global TechnoScience Vitaly G. Gorokhov Institute for Philosophy of the Russian Academy of Sciences, Institute of Technology Assessment and Systems Analysis of the Research Center Karlsruhe (Germany) Vitaly.Grorokhov@itas.fzk.de "Bioterrorism and chemical warfare are not unthinkable. ... 2] But these conditions do not else exist for the time being in nanoscience and nanotechnology. ...

Еще в разделе: (Показать все результаты (>9) - iisi.msu.ru/ )

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>22) - engineering.phys.msu.ru/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>55) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Science :: Conference :: VIII International Conference
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>10) - www.issp.ac.ru/ )

Afterpulses measurements for the ANTARES PMT Vladimir Kulikovskiy INFN Genova / SINP MSU 07/06/2011 Afterpulses measerements, V.Kulikovskiy, INFN Genova / SINP MSU 01/10 Spurious pulses l Afterpulses type 1. l l 1a due to escaped e1b due to escaped l l l 2) afterpulse type 2. ... Afterpulses measerements, V.Kulikovskiy, INFN Genova / SINP MSU 04/10 Pre-pulses & late pulses. ... Prepulse and delayed pulse ­ are the "main" pulses (one pulse only). main pulse afterpulse 1.0%. ...

Еще в разделе: (Показать все результаты (>16) - antares.sinp.msu.ru/ )

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>86) - www.prof.msu.ru/ )

• Discovering America
• Short meetings in the States
• NORTH-SOUTH GAP AND ITS IMPLICATIONS

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>28) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial

OLEA EUROPAEA (OLIVE) OLIVE TAXONOMY Kingdom: plantae Order: lamiales Family: Oleaceae Genus: Olea Species: O. Europaea MORPHOLOGY Root System: great root system allows tree to grow in dry climates could grow from 15cm to 6 meters depending on the climate and type of soil Trunk: younger trees have smooth gray/green bark. ... HARVESTING Harvesting for Oil Step 1 Harvest as soon as the fruit reaches maximum size. ... Tree shakers and mechanical rakes can also be used when harvesting olives for oil. ...

Еще в разделе: (Показать все результаты (>220) - herba.msu.ru/ )

• http://herba.msu.ru/shipunov/school/biol_154/2010_2011/lab_03.pdf
• Systema Naturae
• Complete flora of islands and lakes as a statistical hypothesis

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>38) - shamolin2.imec.msu.ru/ )

• Maxim V. Shamolin Home Page

... Influence of Low Frequency Acoustic Field on Evaporation of Water Pellicles and Single Drops in Capillaries . ... In our report we've considered one of the ways low frequency acoustic waves influence the permeability of porous medium, connected with stimulating of the evaporation processes of water films and single props. ... Dynamics of the evaporation of a single drop under the influence of a low frequency acoustic field on the porous medium has been considered separately. ...

Еще в разделе: (Показать все результаты (>146) - acs366.phys.msu.su/ )

• General Information

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>40) - scon155.phys.msu.su/ )

• Influence of random fields on the ferroelectric phase transition in IV-VI

... Reversibility of nucleoside diphosphate kinase solubilization from the surface of the outer mitochondrial membrane. ... It was found that in medium with low ionic strength nucleoside diphosphate kinase (NDPK) solubilization from the outer membrane of liver mitochondria could be partially reversed by the addition of 3.3 mM MgCl2. ... After solubilization of NDPK in the absence of leupeptin, cathepsins damage sites of its binding on the membranes. ...

Еще в разделе: (Показать все результаты (>33) - biochem.bio.msu.ru/ )

• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase
• Biochemistry Department of Moscow State University | Na,K-ATPase and its role

... Some considerations on cave minerals onthogeny: sulfates filamentary crystals and their aggregates . ... Some new aggregates, based on filamentary crystals growth, are described. ... Filamentary and acicular gypsum crystals (in some cases formed with other minerals), and their aggregates (antholites or flowers, "hair", "beards", "cotton", etc.), are rather common in caves, and are mostly studied well. ... This means crystallization in pores of corresponding diameter. ... Gypsum beard, 12cm long. ...

Еще в разделе: (Показать все результаты (>362) - geo.web.ru/ )

• Calendar Converter
• Mineral Drawings site. Books,references,aesthetical genetic mineralogy

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>205) - polly.phys.msu.ru/ )

• Seminar in Polymer Physics
• PSMTLab - Liquid Crystals
• About me

... 2001 January 18 . 2001: A Total Lunar Eclipse . ... Explanation: The first and only total lunar eclipse for the year 2001 occured on the evening of January 9/10 as the full Moon glided through Earth's shadow. ... The fact that the northern (top) portion of the eclipsed Moon is clearly brighter, even near mid-totality, demonstrates that Earth's shadow is not uniformly dark. Tomorrow's picture: Black Holes Are Black . ... About APOD | ...

Еще в разделе: (Показать все результаты (>67) - www.arcetri.astro.it/ )

• APOD: January 6, 1996 - Dwarf Elliptical Galaxy M32
• APOD: 2000 December 29 - The Dark Horsehead Nebula
• APOD: August 19, 1999 - Light From The Dark Sun

The laboratory runs currently several scientific projects aimed at the foundations of quantum information science (the theories of quantum measurement and entanglement, design and analysis of quantum cryptographic protocols, atoms dynamics in optical dipole trap, etc.), applications of quantum theory to modeling quantum interference phenomena in multilevel atoms interacting with optical and magnetic fields (dark resonance spectroscopy), and exploring ... Physics 96 (4), 629-642 (2003). ...

Еще в разделе: (Показать все результаты (>69) - qilab.phys.msu.ru/ )

First Session : a general experimental and theoretical framework (Chair: A. Masiero) . Dark Matter: the experimental quest in the laboratory (C. RUBBIA) . LHC impact on Dark Matter searches (D. CERDENO) . ... Second Session : review of running Dark Matter experiments at LNGS and their future perspectives (Chair: E. COCCIA) . ... Fourth Session : review on the status and perspectives of Dark Matter searches carried out around the world and review of new proposals at LNGS (Chair: R. CASHMORE) . ...

Еще в разделе: (Показать все результаты (>147) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение расстояния между источником и детектором

... That segment of good times that have been forgotten . ... Forgotten times . Moore Memorial Church, 316 Middle Xizang rd. ... By 1925 it had 1200 followers. ... Two-story hall with wooden seats for choir, Gothic ceilings, arch window. ... Textured patterns and scarlet brick walls, windows graced by dark grey stone quoins. 42.1-meter high bell tower was one of the highest in the city, the church - was one of the largest in China at that time. ... To the sixth trip . ...

Еще в разделе: (Показать все результаты (>167) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.
• Russian SETI
• Natural Satellites Service. Special Ephemerides