ERROR: You need to create the directory /home/www/hist/vledata with web server write access . ... В настоящее время материалы дистанционной поддержки к курсам, читающимся на историческом факультете МГУ им. М.В.Ломоносова, вы можете найти по адресу: vle.hist.msu.ru Skip Calendar . ...

Еще в разделе: (Показать все результаты (>37642) - hist.msu.ru/ )

• Center for Ukrainian and Belorussian Studies, Faculty of History, Moscow State

The Department of Talented Youth Affairs and Professional Orientation . ... The Faculty of Journalism of Moscow State University has announced the contest for the design creation of ?Space University? logotype and emblem. ... Criteria for the appraisal of the design: . ... Contest dates: from February 15, 2016 till May 15, 2016. For more information about the contest visit the website: www.journ.msu.ru . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>53) - talant.msu.ru/ )

• The First International Conference for Young Scientists ?Biophysics.
• editor | The Department of Talented Youth Affairs and Professional Orientation
• News | The Department of Talented Youth Affairs and Professional Orientation |

Lomonosov Moscow State University . ... Academic Programs . ... Academic Departments Programs . ... Russian Language Program . ... There is a well-known fact that if one doesn't know any foreign languages, he has no notion about his mother tongue. ... Moreover, the academic content is connected with the creation of texts in the Russian language relevant to a plan of a speaker and a writer. ... Address: MSU, Faculty of Foreign Languages and Area Studies, Russia, 119192, Moscow, 31/1, rooms 234-235 . ...

Еще в разделе: (Показать все результаты (>1328) - ffl.msu.ru/ )

• Contact Us
• Academic Life

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... We plan to create a multi-channel analyzer through a detector which comprises a semiconductor in addition to the selective line of resistive type sensors , the sampling system also allowing to carry out a catalytic conversion and concentration of target gases. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>24) - www.lssm.inorg.chem.msu.ru/ )

• Лаборатория химии и физики полупроводниковых и сенсорных материалов |

... More Reports . ... Defence calls reflect levels of discomfort in the pallid gerbil ( Gerbillus perpallidus ) // Advances in Ethology. Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ... In contrast, winners never called. ... We assumed that a shortening of the distance between combatants reflected an increase of discomfort for the loser (caller), whereas an increased distance reflected decreased discomfort. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>62) - vertebrata.bio.msu.ru/ )

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>146) - www.physcareer.ru/ )

• ЗАО КБ 'Ситибанк' ПРИГЛАШАЕТ НА РАБОТУ / Вакансии / Physcareer.ru
• HP Graduate Development Program 2010 / Вакансии / Physcareer.ru

The use of the external module Ab_An.dll Ab_An.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of albite- anortite solid solution. ... A non-ideal model of albite-anortite solid solution, proposed in literature [1], is used in this module. ... Preparation of the System file To be able to use the module Ab_An.dll, you need to include a binary solid solution of albite and anortite into the System file, as you create it. ...

Еще в разделе: (Показать все результаты (>96) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• http://www.geol.msu.ru/deps/geophys/gravity.htm
• http://www.geol.msu.ru/deps/geochems/soft/en/H2O-H2S-NaCl.doc

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

. Published since 1829 . Editor in Chief: A.S. Severtsov . Editorial Board :V.N. Pavlov (Assistant Editor), Yu.A. Dubrovsky, F.Ya. Dzerzhinsky, R.D. Zhantiev, V.G. Krivenko, M.V. Mina, E.N. Mirzoyan, O. P.Poltaruha, D.D.Sokoloff, V.G. Onipchenko, A.V. Sviridov, G.N. Simkin, M.V. Nilova (Secretary), P.S. Tomkovich.

Еще в разделе: (Показать все результаты (>426) - herba.msu.ru/ )

INTERNET TECHNOLOGIES AND NEW CONCEPTION OF WDCs SYSTEM P.Yu.Pletchov, (Computer Center, RAS, Moscow, Russia, E-mail: lym@ccas.ru) Yu.S.Tyupkin (National Geophysical Committee of Russia Federation and Geophysical Center of RAS, Moscow, Russia, E-mail: tyupkin@wdcb.rssi.ru) In this technical report we wish to discuss the problem of setting up the distributed information system as a part of new conception of World Data Centers system. ... 4) Editing descriptions of an information resource by user. ...

Еще в разделе: (Показать все результаты (>471) - geo.web.ru/ )

• Pletchov Pavel biography info

E.P. Gordov, M.V. Kabanov, V.A. Krutikov, V.I. Kuzin, V.N. Lykosov, I.G. Okladnikov, A.G. Titov, E.A. Vaganov. Siberia Integrated Regional Study information - computational and instrumental infrastructure development. Abstracts of reports on the American Geophysical Union Fall Meeting 2011, 5 - 9 December 2011, San-Francisco, USA . ... It should create an information basis for decision-making on future socio-economic development of Siberia. ...

Еще в разделе: (Показать все результаты (>124) - srcc.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Re: Принимаються заказы на зв. карты Creative X-Fi exteme music ret. n [ re: Panzer ] . ... Re: Принимаються заказы на зв. карты Creative X-Fi exteme music ret. n [ re: Je ] . ...

Еще в разделе: (Показать все результаты (>2155) - www.snto-msu.net/ )

• Re: creative - Public forum of MSU united student networks
• SB Creative ДЕШЕВО - Public forum of MSU united student networks
• Re: Новинки программного обеспечения - Public forum of MSU united student

.

Еще в разделе: (Показать все результаты (>170) - nuclphys.sinp.msu.ru/ )

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>143) - genphys.phys.msu.su/ )

• To Do List History

... 379.08 KB . ... 362.46 KB . ... 372.72 KB . ... 380.65 KB . ... 373.13 KB . ... 366.63 KB . ... 374.91 KB . ...

Еще в разделе: (Показать все результаты (>319) - www.geogr.msu.ru/ )

• PARTICIPATION IN UNCCD E-LEANING COURSES AND SUPPORT TO THE 2014 REPORTING

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>215) - www.genebee.msu.ru/ )

• Основной заголовок
• BLAST 2.0 Release Notes
• GeneBee BLAST 2.2.8 Services Help

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>34) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>5) - unesco.fgp.msu.ru/ )

... Creation of catalytically active particles from enzymes crosslinked with a natural bifunctional agent--homocysteine thiolactone. ... The current study describes an approach to creation of catalytically active particles with increased stability from enzymes by N-homocysteinylation, a naturally presented protein modification. ... Modification of these proteins concerns the accessible lysine residues and introduces an average of 2-2,5 homocysteine residues per protein monomer. ...

Еще в разделе: (Показать все результаты (>35) - biochem.bio.msu.ru/ )

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>40) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf