... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>146) - www.genebee.msu.ru/ )

• BLAST Frequently Asked Questions (FAQ)
• Screening by similarity
• BLAST Reference Manual Pages

... Formulation of the problem ­ angle about the mass center C IC = mR 2 ­ central moment of inertia m and R ­ mass and radius of the hula-hoop k ­ coefficient of viscous friction r ­ radius of the waist FT ­ friction force N ­ reaction force ­ angle between x and CO x = a sin t , IC m m Ё +k (R - (R - y = b cos t = -FT R r ) = m (x sin + y cos ) + FT Ё Ё Ё r ) 2 = m (x cos - y sin ) + N Ё Ё (R - r ) = R ­ non-slippage where constants 0 mod 2 are defined from + µ cos 0 = 0. ...

Еще в разделе: (Показать все результаты (>12) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/ENOC2014Presentation.pdf
• http://belyakov.imec.msu.ru/papers/SPbGTU2003.pdf
• http://belyakov.imec.msu.ru/papers/ENOC2008.pdf

SDPpred: a tool for prediction of amino acid residues that determine differences in functional specificity of homologous proteins . ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ... As colored columns of the alignment. ...

Еще в разделе: (Показать все результаты (>66) - monkey.belozersky.msu.ru/ )

• HF clusters: algorithm
• SDP home page
• Hydrophobic clusters

... Need the algorithms, allowing find beginning contamination before that moment, when ecological situation will gain the disastrous nature i.e. algorithms, which can find change a characteristic ambiences, bring about ecological breaches, and form the statistical forecast of the condition of the ambience. ... The Algorithms of the consequent finding are founded on method of the most quick finding the change characteristic (the ) of the casual process, allowing execute data processing a real-time. ...

Еще в разделе: (Показать все результаты (>175) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc15810/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc18923/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc15826/doc.pdf

... Molecular Mechanics Calculations of beta-Diketonate, Aqua, And Aqua-beta-Diketonate Complexes of Lanthanide Ions Using Gillespie-Kepert Model . ... Abstract - A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. ... For the aqua complexes, typical root-mean-square deviation (calculated vs. ...

Еще в разделе: (Показать все результаты (>20) - analyt.chem.msu.ru/ )

• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on
• Molecular mechanics study of the mixed-ligand lanthanide complexes using
• Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert

DESCRIPTION OF THE TIME PROFILES OF KEY GEOMAGNETIC AND SOLAR WIND PARAMETERS . Time profiles of key geomagnetic parameters ( Ap and Dst indices) are shown together with key parameters of the solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM coordinate system). ... High time resolution data on the solar wind plasma is obtained from Wind experiment in 1997 and ACE experiment in 1998-2002 using ISTP data base . ...

Еще в разделе: (Показать все результаты (>8) - dbserv.sinp.msu.ru/ )

• Catalogue of Space Storms

... 3D magnetosphere . ... Data . ... Magnetosphere . ... Magnetic field at the selected point Module of the Magnetic field distribution along Sun-Earth line Noon-Midnight magnetosphere structure . ... Point coordinates, where magnetic field will be calculated: . ... Magnetic field at MD outer edge . ... Magnetic field at TC inner edge . ... Distance to external edge of MD . ... Distance to inner edge of MD . ... Magnetopause stand-off distance . ... Distance to inner edge of geotail current sheet . ...

Еще в разделе: (Показать все результаты (>96) - swx.sinp.msu.ru/ )

• SWX - Прогноз Dst

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

80. Change-points at different levels of the hierarchy of EEG segmental...