Вы посетили: activ_engl.html . ... История кафедры . ... Editor of the special issue of the journal Linear Algebra and its Applications devoted to Idempotent and Tropical Mathematics, 2010 . Editor of the journal Fundamental and Applied Mathematics . ... Linear Algebra and its Applications . Linear and Multilinear Algebra . ... Electronic Journal of Linear Algebra . ... staff/guterman/activ_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>10) - halgebra.math.msu.su/ )

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>44) - sn.sai.msu.ru/ )

... IPI program works with group of sounding curves (from 1 to 100) in one data file. ... If Type of Array is =+3 or +4, then: 7 line : Name of VES (from 1 to 8 symbols) 8 line : number of distances for this VES . 9 line : dV values (in mV or V) 10 line : I values (in mA or A) Examples of *.dtg file : Example 1 for stabilized current AMN array Bilibino-90, VES from 24.5 to 43.0. 1 2 lines - description of data profile 4 1 0 17 1 -3 S { VES number , KeyIP, ?ax.nAB, ...

Еще в разделе: (Показать все результаты (>73) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/Basic_IP2_Win_Tutorial.pdf
• Page 2

... Faculty . ... cmcproject@cs.msu.ru . ... head of the portal support working group . ... The portal was established in accordance with orders of the Dean of CMC Faculty Evgenyi Ivanovich Moiseev ? ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... Second CMC MSU ? ... Delegation from Tohoku University (Japan) at CMC MSU . ... The Faculty Site is in the adjustment state. Any comments on the contents and functioning of the site should be addressed to cmcproject@cs.msu.ru . ...

Еще в разделе: (Показать все результаты (>100) - en.cs.msu.ru/ )

• About this site
• Laboratory of Programming Technologies
• Laboratory of Programming Technologies | CMC MSU

... importance of terms such as 'geosols', 'paleosols' etc with interest. ... new zealand perspective is similar to that of Dr Crook of Australia - the . ... Some Quaternarists in New Zealand use 'buried soil' instead of buried . paleosol and the distinction is one of preference in the end (e.g Almond . ... I use the simple definition of a paleosol as a soil of a past landscape or . ... paleosols, and exhumed paleosols. ... surface' or 'non-buried' paleosols because these soils are clearly in the . ...

Еще в разделе: (Показать все результаты (>161) - www.fadr.msu.ru/ )

• INQUA/ISSS PALEOPEDOLOGY COMMISSION NEWSLETTER
• Working Groups
• the paleopedology working group had a conference last year in Mexico on "Global

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Servant >> Forum (Archive) . ... ФР]Специальный тег для картинок not safe for work . ... Re: [ФР]Специальный тег для картинок not safe for work [ re: mr_tron ] . ...

Еще в разделе: (Показать все результаты (>6818) - www.fds-net.ru/ )

• Новинки программного обеспечения - Public forum of MSU united student networks
• [News] Научное программное обеспечение - Public forum of MSU united student
• GNU Octave 3.0 released - Public forum of MSU united student networks

Predictor of DVM-program performance . User's guide . ... With the predictor user can get the predicted time characteristics of execution of his program on MPP or workstation cluster in more or less details. The predictor is the system for processing the trace information gathered by DVM-program Run-Time system (Lib-DVM library) during the program execution on a workstation and consists of two major components: trace interpreter ( PRESAGE) and time estimator (RATER). ... Program execution. ...

Еще в разделе: (Показать все результаты (>202) - sp.cs.msu.ru/ )

• DVM-system. Installation guide. Version 3.95
• DVM-system. Installation guide. Version 3.93
• Debugging DVM-program. User's guide. Part 1

... x264 is an open source codec of standard MPEG4 AVC/H.264, developed by programmers from all over the world. ... Accumulated during previous frames' compressions statistic is actively used by codec to improve effectiveness of adaptive models. ... These parameters are used only before encoding start, so, our improvements are more significant for short sequences. ... 3 Results of codec x264 modification on "flower" sequence . ... 5 Results of codec x264 modification on "flower" sequence, low bitrates ....

Еще в разделе: (Показать все результаты (>220) - graphics.cs.msu.ru/ )

• x264 codec improvement | Лаборатория компьютерной графики и мультимедиа
• GML MatLab Camera Calibration Toolbox | Graphics and Media Lab
• Congratulations to winners of course work competition in CMC MSU! | Graphics

... Please retype /font /b /td /tr % } tr td class = form nbsp; b Your name: /b /td td class =formi input type=text size= 60 value= %$ author % name= author /td /tr tr td class = form nbsp; b Your e-Mail: /b /td td class =formi input type=text size= 60 value= %$ dbh->quote($author) . ... br>"); return -1; } my $last_id=DB_functions::get_max_id($dbh,$tree,'id'); my $parent = ($id>0)?$id:0; if (!$dbh->do("INSERT INTO $tree (id,parent,resource) VALUES ( $last_id," . ...

Еще в разделе: (Показать все результаты (>212) - www.kosmofizika.ru/ )

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>22) - ecology.genebee.msu.ru/ )

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>238) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

by Margarita Dzhalalova It is known that the pressure difference values for a round parachute are constant over total canopy, then for a square parachute the values of pressure difference are non-uniform along radial ribbons differing even from each other and depending mainly on certain sets of line lengths, and therefore square parachutes attain different shapes from each other ( Fig.1 - photo of var.1 and var.2). ... Distribution of pressure coefficient along radial ribbons of square parachute. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

USE OF IS EVIDENT-SHAPED MODELLING AND COMPUTER INTERACTIVE PROGRAMS IN WORK ON DEVELOPMENT OF ACOUSTICAL PERCEPTION AND COHERENT SPEECH. ... On the basis of our methodical working out the interactive multimedia computer program on development of the acoustical perception, containing work on nonverbal sounds is created: natural (water, fire, air) noise (household, city), (voices of animals and birds); over speech sounds. ... On the basis of our technique the interactive computer program is created. ...

Еще в разделе: (Показать все результаты (>255) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc15776/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc97016/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc97508/eng.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>4) - www.law.msu.ru/ )

Distributed systems as pattern formation models: space-time behavior investigation and elements of dynamics control". ... A new method of local dynamics analysis of coupled map lattices (CML) was proposed. ... New effects of global behavior of CML was found. Maps can represent some systems. ... And the points represent state of the system, which was determined by Rybalko method (Lambda values; color = period = order, black = zero period = chaos) and the period of cycle (P values). ...

Еще в разделе: (Показать все результаты (>68) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Letter_to_editor.pdf
• Staff

NATO Advanced Research Workshop . ... From theory to practice . ... Dear NATO-ARW Participants and NATO-Book Contributors: . ... This is a concluding infoletter on the NATO-ARW "Use of humates to remediate polluted environments: from theory to practice". ... The scientific output of the ARW as a whole is to be accomplished with issuing a book: "Use of humic substances to remediate polluted environments: from theory to practice" as a NATO ASI SERIES VOLUME, Kluwer Academic Publishers, Dordrecht. ...

Еще в разделе: (Показать все результаты (>146) - mgumus.chem.msu.ru/ )

• June 2004, Diploma workers
• MGUMUS -- Philippe Schmitt-Kopplin

... FPGA design, architecture, means and methods of work. ... FPGA stands for Field-Programmable Gate Array, which is a semi-conductive crystal, the connections between gates of which and the logic of work can be modeled and changed repeatedly during its work. ... Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ... In spring semester students have 44 hours to work on their term papers on design and then 4 hours for defending...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

D'yachenko D.M. Two-Side Estimates for Sums of Absolute Values of Fourier Coefficients of Functions from H ? ... Bakhvalov A.N. Fourier Coefficients of Functions from Many-Dimensional Classes of Bounded ?- ... Vorontsov A.S. Kronecker Indices of Lie Algebras and Invariants Degrees Estimate . Derkach M.M. and Ten A.S. Maximal Commutative Subalgebras of Functions on Spaces Dual to Lie Algebras . ... Panev A.A., Vavilova N.B. The Navigation Problem for a Pipeline Inspection System . ...

Еще в разделе: (Показать все результаты (>130) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

FAST RANK ALGORITHMS WITH MULTISCALE HISTOGRAMS LAZY UPDATING1 M. Storozhilova2, D. Yurin 2,3 3 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia. mariastorozhilova@gmail.com2, yurin@cs.msu.su3 Rank algorithms propose good solutions for image smoothing and impulse noise removing. ... The main idea of our lazy algorithm is based on histogram updating approach from [2]. ...

Еще в разделе: (Показать все результаты (>96) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.OGRW.Yatchenko_Krylov_Nasonov.RingingMRI.en.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Yatchenko_Krylov_Nasonov.RingingMRI.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Chernomorets_Krylov_Nasonov_Semashko.Retina.en.pdf