... Форумы > Разное > Тема > Страница 2 . ... Форумы Список тем Новая тема . 05.02.2003 12:11 . ... Ответить Цитировать . ... Computer science is a discipline that involves the understanding and design of computers and computational processes. ... Because of the rapid evolution it is difficult to provide a complete list of computer science areas. ... Definition courtesy of Computing Sciences Accreditation Board . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>6588) - www.mmonline.ru/ )

• Математический семинар глобус, заседание 26 апреля 2005 г.
• MMOnline | Форумы | Аспирантура | PhD position at the University of Geneva,
• MMOnline | Форумы | Разное | Требуется Web - дизайнер.

Theoretical problems of electrical double layer structure on ideally polarizable electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistep electrochemical processes limited by mass transfer, electron transfer and chemical reaction. Special attention is paid to computer simulation of specific adsorption and coadsorption of ions and neutral organic molecules on the electrode surfaces. ...

Еще в разделе: (Показать все результаты (>76) - electr003.chem.msu.ru/ )

The preliminary program . of the International Congress . Russian Language: . ... Problems of historical Russian linguistics within Common Slavic and Indo-European context: inheritance, development, cultural contacts. ... Dynamic picture of modern Russian language synchrony . ... Stable features of modern Russian public language: factors and tendencies of the development of its means and genres. ... New features and aspects of Russian fiction language of the end of XX-th century research. ...

Еще в разделе: (Показать все результаты (>391) - www.philol.msu.ru/ )

• УЧЕБНО-НАУЧНЫЙ КОМПЬЮТЕРНЫЙ ЦЕНТР
• MSU-LGCLL:: Curriculum Vitae of Anatoliy Anatolyevich Polikarpov
• SCIENTIFIC AND TEACHING COMPUTER CENTRE

... Лекторий по физике . ... Главная / О факультете / Подразделения факультета / Отделения и кафедры / Кафедра компьютерных методов в физике . ... Методы анализа и интерпретации эксперимента . Математические методы анализа и интерпретации эксперимента разрабатывались на кафедре под руководством проф. Пытьева Ю.П. более 25 лет. ... Методы позволяют эффективно учитывать симметрию решаемой задачи анализа и интерпретации, а также трудно формализуемые сведения о моделируемых объектах и явлениях. ...

Еще в разделе: (Показать все результаты (>193) - phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

The Center for Theoretical Problems in the Historical Sciences . ... The need to organize the new structure within the framework of Moscow State University was necessitated by the rapid advancement of the historical sciences in Russia, and furthermore, by the position which Moscow State University’s history faculty occupies, as the center of university history faculties in the Russian Federation. ...

Еще в разделе: (Показать все результаты (>275) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal
• Department of Ethnology

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>163) - new.math.msu.su/ )

• Osipenko Konstantin Yuryevich | Department: General Problems of Control.
• Pobedria Boris Efimovich
• Seminars of the department | Department: General Problems of Control. Faculty

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>74) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• TES tecnology. MSU.
• TES. Modeling example.

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... When detection of the change-points in alpha band power was performed as in the previous subsection, more than one change-point per second was obtained in average. ... The hypothesis of the hierarchy of EEG segmental descriptions (Kaplan 1998) (see subsection 7.3.2) is a theoretical reason for introducing the adjustment of the change-point detection probability. ...

Еще в разделе: (Показать все результаты (>80) - brain.bio.msu.ru/ )

• Laboratory for Neurophysiology and Neuro-Computer Interfaces (NNCI) (former
• Unsolved problems and new prospects
• Alexander Kaplan * Александр Каплан

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>338) - www.geogr.msu.ru/ )

• CONTENTS ?2 - 2009

Teaching Experience . Current lecture topics: Introduction in modern problems of Dynamical Systems Theory . ... Methods of Mathematical Physics (2003-2009) . Introduction in Theoretical Physics (topics in Statistical Physics of Networks) (2006-2009) . ... Theoretical Physics (Classical Mechanics, Quantum Mechanics, Statistical Mechanics, Electrodynamics) (2000-2005) . Experience as a supervisor of PhD studies: 2 PhD are defended under my surevision; 2 PhD students recently. ...

Еще в разделе: (Показать все результаты (>75) - chaos.phys.msu.ru/ )

• Science

Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>20) - www.elch.chem.msu.ru/ )

... 13 ALLSPHINXOPTS = -d $( BUILDDIR ) /doctrees $( PAPEROPT_ $( PAPER )) $( SPHINXOPTS ) source . ... 18 @echo "Please use \`make <target>' where <target> is one of" . 19 @echo " html to make standalone HTML files" . 20 @echo " dirhtml to make HTML files named index.html in directories" . ... 23 @echo " htmlhelp to make HTML files and a HTML help project" . 24 @echo " qthelp to make HTML files and a qthelp project" . ... 64 @echo "# qcollectiongenerator $(BUILDDIR)/qthelp/allpy.qhcp" . ...

Еще в разделе: (Показать все результаты (>21414) - kodomo.fbb.msu.ru/ )

• allpy: ca2cf2377bed debian/changelog
• allpy: e57eb57e6328 docs/Makefile
• allpy: 1208a7ec6e1b docs/Makefile

Galina K. Vasilyeva , PhD, senior researcher at the Institute of Physical Chemical and Biological Problems in Soil Science, Russian Academy of Sciences (IPBPSS RAS), head of group of soil bioremediation. Tel. (of.) 096) 773-3830. ... Participant of Russian-American exchange programs: 1. ... Nadezhda D. Anan'eva , PhD, Chief of the Laboratory of soil microbiology at the Institute of Physical Chemical and Biological Problems in Soil Science, Russian Academy of Sciences (IPBPSS RAS). ...

Еще в разделе: (Показать все результаты (>163) - www.prof.msu.ru/ )

• Internationalizing Education In Barnaul State Pedagogical University
• One effective method to turn passive students into active learners in Russian
• About the importance of founding teleecommunication centres in developing areas

... General Psychology . Psychophysiology . ... Social Psychology . ... Psychological Principles of Personality Correction . ... Historical Psychology of Personality . ... Psychophysiology of Functional States . ... Social Psychophysiology . ... Psychological Influences on a Person in Clinical Psychology . ... Non-Russian Social Psychology in 20 th Century . ... Social Psychology of Personality . ... Process of Investigation in Social Psychology . ... Qualitative Analysis in Social Psychology . ...

Еще в разделе: (Показать все результаты (>186) - www.psy.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

77. Apache2 Ubuntu Default Page: It works