Using GibbsLib.dll in user's applications Contents Introduction 2 Creating and deleting the object Gibbs 2 Gibbs object properties 3 Common Gibbs properties 3 Special Gibbs properties 4 Gibbs object methods 6 Common Gibbs methods 6 CallGibbs 6 ReCallGibbs 7 SetFugacities 8 CancelGibbs 9 ShutDown 9 Special ... mode option) of i-th species: | ... If used, this property must be set before SystemFile, as some options affect the way System files are read (see "Gibbs options" below). ...

Еще в разделе: (Показать все результаты (>78) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Ab_An.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/Unitherm.doc

The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...

Еще в разделе: (Показать все результаты (>6719) - cosmos.msu.ru/ )

... The system is based on two methods: concatenation of allophones' waveforms and prosodic rules to control fundamental frequency, duration and intensity. ... Signal generation is implemented according to the phrase control file, which describes the phrase as a sequence of allophones code names with assigned duration, energy and fundamental frequency values. ... The strategy of pitch generation in each intonational submodule is as follows. ... Generation the result sequence (Nj,T0j,Ni) P1. ...

Еще в разделе: (Показать все результаты (>342) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/fdsl/abstracts/mcdonald.pdf
• http://www.philol.msu.ru/~otipl/new/fdsl/abstracts/madariaga.pdf
• http://www.philol.msu.ru/~otipl/new/fdsl/abstracts/slioussar.pdf

... DYNAMIC OF RHEOLOGICALY STRATIFIED LITHOSPHERE UNDER CONTINENTAL COLLISION. Electronic version of Ph.D. thesis . ... Purpose of work - constructing of quantitative model of mechanical and thermal processes occurring in the lithosphere, having simplified 3-layers construction (rigid upper, plastic lower crust, rigid mantle lithosphere), under continental collision. ... Stress t xz and strain rate in lower crust, calculated from model M1. a)5 m.y.; b)20 m.y. from the beginning of collision. ...

Еще в разделе: (Показать все результаты (>29) - dynamo.geol.msu.ru/ )

• Доклады В.С.Захарова

Moscow State University . Physics Department . ... Home :: History of Research :: History of Research in Polymer Physics at the Physics Department of Moscow State University . ... Studies in polymer theory were initiated at the Physics Department of Moscow State University by Professor I.M.Lifshitz (1917-1982). ... A.Yu.Grosberg, I.Ya.Erukhimovich and A.R.Khokhlov were among his first students. ... Grosberg, A.R. Khokhlov. ... Statistical Theory of Polymeric Lyotropic Liquid Crystals. ...

Еще в разделе: (Показать все результаты (>264) - polly.phys.msu.ru/ )

• Scientific
• site Carousel With Variable Elements Widths | Lemmon jQuery
• lab Carousel With Variable Elements Widths | Lemmon jQuery

... Форумы > Разное > Тема . Автор темы Dr.Neurosurgus . Форумы Список тем Новая тема . ... Publication/Reference Managers . ... чем народ пользуется, чтобы не утонуть в базе ссылок по публикациям по своей теме? . не одними же Reference Manager и ProCite . ... http://forum.khamenya.ru . Ответить Цитировать . ... на сцайнтифике в general форуме . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>127) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное

Справочники по истории на русском языке в Интернете . ... Хотя мы считаем, что на нижеперечисленных сайтах собрана полезная информация, . ... Хронологические таблицы по истории Азии I-XVIII вв. на Центральноазиатском историческом сервере . ... статьи из Брокгауза и Ефрона . ... Малый энциклопедический словарь Брокгауза и Ефрона также на разных сайтах: . ... Информация о руководителях различных государств, ныне существующих и существовавших в истории. ... Справочник по истории Третьего Рейха . ...

Еще в разделе: (Показать все результаты (>112) - hist.msu.ru/ )

• The Rural Roads as the Structural Element of the Roman Organization of Land

... This gropup of options allows You to change the following speech recording parameters: . ... This gropup of options allows You to change the following parameters of linear prediction: coefficients calculation: . ... This gropup of options allows You to change the following speech processing parameters: . ... This gropup of options allows You to change the following speech recognition parameters: . ... This gropup of options allows You to change the following speech detection parameters: . ...

Еще в разделе: (Показать все результаты (>79) - www.intsys.msu.ru/ )

• Интеллектуальные системы :: Сотрудники :: Гасанов Эльяр Эльдарович :: Instantly
• Options

... Science . ... lrm@cs.msu.su . ... The Laboratory of Difference Methods was founded by A.A.Samarsky, Academician of RAS, in the middle of the 60s. For more than 50 years the Laboratory?s theoretical research has been focused on numerical methods for problems described by systems of partial differential equations. ... N.V.Ardelyan, V.L.Bychkov, I.V.Kochetov and K.V.Kosmachevskii, Non-self-maintained discharge plasma in propane-air mixture // IEEE Trans. on Plasma Science, vol. 39. no. 12, part 1, pp. ...

Еще в разделе: (Показать все результаты (>121) - en.cs.msu.ru/ )

• Laboratory of Difference Methods

PTOLEMY'S FAILINGS . ... The Crime of Claudius Ptolemy. ... Almost as a stocktaking of Ptolemy , the 1970s saw the publication of three monographic writings on his astronomy , viz, O. Neugebauer's authoritative account of the contents of the Almagest in its context of the mathematical side of the rest of ancient astronomy , 1 O. Pedersen's Almagest companion volume designed to guide also the student of Latin astronomy up to the Renaissance, 2 and R. R. Newton's ...

Еще в разделе: (Показать все результаты (>102) - hbar.phys.msu.ru/ )

• The jump of the second derivative of the moon's elongation

... The models represent spatially inhomogeneous diffusively concatenated systems of one-dimensional piecewise-continuous maps. ... The area of regular dynamics in the space of the parameters is estimated analytically. ... Annular model with a single defect. ... For all systems whose spatial inhomogeiieity is related to the presence of two types of elements that differ by a parameter value, a lower estimate for the regular ensemble dynamics domain in the space of the parameters was derived analytically....

Еще в разделе: (Показать все результаты (>70) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/TechPhLt10_04_engl.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/TMPh_quadratic_cml.PDF
• http://chaos.phys.msu.ru/prokhorov/phd/tmf_eng.pdf

Hybrid States of Surface and Tamm Plasmon-Polaritons in Photonic Crystals B.I. Afinogenov, V.O. Bessonov, I.V. Soboleva, and A.A. Fedyanin Lomonosov Moscow State University, 1 Leninskie gory, 119991 Moscow, Russia afinogenov@nanolab.phys.msu.ru Abstract: Experimental observation of Tamm plasmon-polariton (TPP) and surface plasmonpolariton (SPP) hybrid mode in metal/photonic crystal system is reported. Interaction bet ween TPP and SPP leads to repulsion of their dispersion curves. ...

Еще в разделе: (Показать все результаты (>211) - nanolab.phys.msu.ru/ )

• Maria N. Romodina (Skryabina) | Laboratory of Nanophotonics & Metamaterials

... 000714 000912 001108 001124 001126 010128 010402 010410 010412 010415 010418 010816 010924 011001 011104 011122 011226 011231 020421 020522 020715 020822 020824 020905 021109 031026 031028 031029 031102 031104 040725 040912 041101 041107 041108 041110 050116 050117 050120 050513 050617 050714 050822 050907 050913 061206 061213 971104 971106 980420 980502 980506 980824 980930 981114 990601 . ... calculated differential fluxes and integral spectra . ...

Еще в разделе: (Показать все результаты (>106) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/database/modules/db.php
• http://swx.sinp.msu.ru/models/database/modules/db2.php
• SWX - Магнитосфера

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

... Development of a candidate secondary reference procedure (immunoassay based measurement procedure of higher metrological order) for cardiac troponin I: I. Antibody characterization and preliminary validation. ... In this study, the first steps in the development of a secondary reference measurement procedure (RMP) 'higher metrological order measurement procedure' to support the cardiac troponin I (cTnI) standardization initiative is described. ...

Еще в разделе: (Показать все результаты (>74) - biochem.bio.msu.ru/ )

• Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>25) - curl.sai.msu.ru/ )

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>31) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And
• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

. Sternberg Astronomical Institute, Moscow, Russia . GENERAL CATALOGUE OF VARIABLE STARS: References . File Summary: . GCVS References . NSV References . NSV Supplement References . The list of the abbreviations in the References .

Еще в разделе: (Показать все результаты (>107) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Vols I-III (the new electronic version).

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

... help . find changesets by author, revision, files, or words in the commit message Subrepositories Subrepositories let you nest external repositories or projects into a parent Mercurial repository, and make commands operate on them as a group. Mercurial currently supports Mercurial, Git, and Subversion subrepositories. ... Note that ".hgsub" does not exist by default in Mercurial repositories, you have to create and add it to the parent repository before using subrepositories. ...

Еще в разделе: (Показать все результаты (>12195) - kodomo.fbb.msu.ru/ )

• allpy: log
• Elements of UNIX