... Notation of symbols used; Bold, italic, roman... 3 te 1 MB = Member body (enter the ISO 3166 two-letter country code, e.g. CN for China; comments from the ISO/CS editing unit are identified by **) 2 Type of comment: ge = general te = technical ed = editorial NOTE Columns 1, 2, 4, 5 are compulsory. page 1 of 5 ISO electronic balloting commenting template/version 2001-10 Template for comments and secretariat observations 1 MB1 2 Clause No./ ... CLOSED: Not accepted BE Be 4.2.2 ed Corrected to "events"...

Еще в разделе: (Показать все результаты (>9) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/ISOTS04.pdf
• Rikho Nymmik

... A new method is proposed that makes it possible to determine the parameters of the three-dimensional (3D) multiwell potential of off-center atoms from extended X-ray absorption fine-structure (EXAFS) data. ... The parameters of the multiwell potential for Ge atoms in the Sn 1-x Ge x Te solid solution as functions of temperature and composition (77<T<300 K, x>0.4) were obtained in the classical approximation. ...

Еще в разделе: (Показать все результаты (>106) - scon155.phys.msu.su/ )

• New methods of measuring photoelectric parameters of silicon
• First-principles calculations of physical properties of crystals
• Hopping in Quasi-One-Dimensional Disordered Solids: Beyond the Nearest-Neighbor

Peremennye Zvezdy ( Variable Stars ) 33 , No. ... From our comparison of magnitudes of bright stars in the Hipparcos catalogue and in the Tien-Shan catalogue of magnitudes, we compiled a list of stars that could be candidate photometric standards in the northern sky. The selected stars were tested for variability using the technique. ... Fig. ... It follows from Fig. 7 that if , then, according to the theory, we should expect the star to be variable. 54 stars are situated in the range. ... star . ...

Еще в разделе: (Показать все результаты (>9419) - www.astronet.ru/ )

• Астронет > Archive of Astronomical and Astrophysical Transactions
• Abell 2744: Pandoras Cluster of Galaxies

... During compilation my gcc 2.7.2.x dies with an "internal compiler error". ... You have to recompile gcc 2.7.2.x, or better yet, install egcs 1.x or gcc 2.8.x. Q: . I have installed gcc 2.8 or egcs, and it still dies with an "internal compiler error". ... You are encouraged to submit a bug report to the appropriate compiler's mailing list. In the meantime, disabling optimization usually works./configure --disable-optimize . ... I configured for namspace support but MICO doesn't compile? ...

Еще в разделе: (Показать все результаты (>677) - rtm-cs.sinp.msu.ru/ )

• Objects in distributed systems
• GNU General Public License
• Unions

Predictor of DVM-program performance . Preliminary design . ... 3.1 Representation of the program as hierarchy of intervals . ... 3.2.2 Simulation of parallel execution of DVM-program . ... The predictor is intended for performance analysis and debugging of DVM-programs without usage of a real parallel computer (access to which is usually limited or complicated). ... time needed for execution of interprocessor communications; . ... execution time; . ... lost time. ... Processor time ( CPU_time ) . ...

Еще в разделе: (Показать все результаты (>163) - sp.cs.msu.ru/ )

• DVM-system. Version history
• Lib-DVM. Preliminary design
• Fortran DVM language description. Part 3 (7-12)

... Next: Index Up: Scanning Probe Microscopy Image Previous: COM-port initialization file format Contents Index . Figure D.1: Parameters of 3D Images . ... Intensity of material emission (Mat. ... material color for diffused light (Mat. ... material reflection color for directed light (Mat. ... material reflection color for reflected light (Mat. ... intensity of directed light (Light Diffuse) . ... Material Shininess) In our case we use the model, where , and this parameter is called Material Color. ...

Еще в разделе: (Показать все результаты (>146) - www.spm.genebee.msu.ru/ )

• Scan parameters
• Plane tab
• Microscope Parameters Data

... J.K. Krylov . In the monography by R. Koehler [1] there was described a very interesting effect of the words' average length oscillation as a function of their frequency of use (according to the data from a representative frequency dictionary). ... In this context, further the Koehler's effect will be definied as polymodal character of the dependence of the conditioned average in cases of two-dimencional distributions of any linguistic nature. ...

Еще в разделе: (Показать все результаты (>66) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization
• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of
• Large transportation networks with finite-dimensional state space. Asimptotic

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . Online Services | ... Links | ... Contacts | ... CDFE => Online Services => Nucleus Ground and Isomeric States Parameters Search Engine . The source of data is the Nuclear Wallet Cards database prepared and maintained by the USA NNDC. ... Show nuclear moments/deformations for selected nuclei . ... Metastable states: . ... If you have any questions, comments, and/or suggestions, please, contact . ...

Еще в разделе: (Показать все результаты (>32) - cdfe.sinp.msu.ru/ )

• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE => Online Services => Calculator and Graph Engine for Atomic Nuclei
• CDFE => Online services => Chart of Nuclear Quadrupole Deformations

... A preliminary survey on nest cavity use by Siberian flying squirrels, Pteromys volans orii , in forests of Hokkaido Island, Japan . ... To broadly understand what nest cavity is selected by P. volans orii in mountainous areas, we preliminary surveyed cavity resources in natural forests of Hokkaido. All nest cavities were on live-trees. ... To understand these usefulness as P. volans orii habitat, we made a preliminary comparison of cavity resources in two different forests common in Hokkaido. ...

Еще в разделе: (Показать все результаты (>1657) - zmmu.msu.ru/ )

• Geographic variation of skull traits in the Libyan jird, Meriones libycus
• Biochemical analysis of the metabolism of small rodents living in different
• Temporal and spatial distribution of Rad51 protein in spermatocytes of the

... 2 ftp://ftp.ebi.ac.uk/pub/databases/rcsb/pdb/data/monomers/components.cif.gz . 3 codes_py = allpy/data/codes.py . 4 components_cif = allpy/data/components.cif . ... 6 all: doc codes tests . ... 11 doc: . 12 sphinx-autopackage --suffix = rst --dest-dir = docs/source/allpy/ allpy . 13 $( MAKE ) -C docs html . ... 15 force-doc: . 16 rm docs/source/allpy/* . 17 rm -rf docs/build . 18 $( MAKE ) doc . ... 20 codes: $( codes_py ) . ... 26 $( codes_py ) : $( components_cif ) . ...

Еще в разделе: (Показать все результаты (>11056) - kodomo.fbb.msu.ru/ )

• allpy: Makefile annotate
• allpy: a0a1273bbe5a Makefile
• allpy: b1d9fb2a7e2a Makefile

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Species distribution . ... According to Pfam database there have been found 487 ETS genes to date, most of which turned out to belong to different species of animal kingdom. ... The following table shows the number of ETS genes present in genomes of most intensively studied species. The number of ETS genes found in genomes of most intensively studied species . ... The following table shows the number of well studied ETS proteins and their distribution among species. ... ETS1, SPI1, SPIB . ...

Еще в разделе: (Показать все результаты (>5502) - monkey.belozersky.msu.ru/ )

• HTH3_species_distribution
• HF clusters: algorithm
• About authors ot this complex

Moss, D., Sokoloff, D., Lanza, A. F..Polar branches of stellar activity waves: dynamo models ad observations. Astronomy and Astrophysics, 531, A43, 12 pages, 2011 . ... Taking into account the preliminary stage both of observations of polar activity branches and of the determination of the governing parameters for stellar dynamos, we restrict our investigation to the simplest mean-field dynamo models, while recognizing more modern approaches to be an essential development. ...

Еще в разделе: (Показать все результаты (>133) - srcc.msu.ru/ )

• Haiqing Xu, Yu Gao, Hongqi Zhang, Takashi Sakurai, Masaoki Hagino, D. Sokoloff,

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

55. http://qi.phys.msu.su/papers/2007-prl-99-063901.pdf

56. SDPsite - Algorithm Format requirements

57. COM

58. http://geophys.geol.msu.ru/shevnin/publ/173.pdf

59. IMCCE-SAI: Natural Satellites Service. Parameters and constants

60. http://site2010.sai.msu.ru/static/doc/BSafonov_site2010.pdf