... Exams . Mathematical Analysis . ... Mechanics . ... Methods of Processing Observation . Tests . ... Mathematical Analisis . ... Theory of Functions of Complex Variables . Probability Theory and Mathematical Statistics . ... Mathematical Methods in Physics . Atomic Physics and Spectroscopy . Electrodynamics and Theory of Radiation . Theoretical Mechanics . ... Quantum Mechanics . ... Course of Specialization . ... Complementary course . Nuclear Physics . ...

Еще в разделе: (Показать все результаты (>55) - comet.sai.msu.ru/ )

• News in Astronomy and Astrophysics
• Dm. Bizyaev Home Page
• Yury Pakhomov (Monstr)

Testing the hypothesis on the 'drift' of parameters in the moving average model / I. G. Erlikh. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2009. ... Test statistics for checking the conformity of the moving average model to observations are constructed. The statistics are based on sequential processes constructed using residuals and compatible with the equation for estimation of the unknown parameter of the model postulated. ...

Еще в разделе: (Показать все результаты (>22) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Editorial
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

... A European science agency? Outlook on science policy . ... Vol. ... Ключевые слова: Финансирование образования. ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ЕВРОПА. ... Ключевые слова: Наука в университетах. ... ДРУГИЕ СТРАНЫ ЕВРОПЫ. СТАТЬИ . ... Guildford, 2001. ... Планы финансирования университетов Канады до 2011 г. Ключевые слова: Финансирование образования. ... Трудоустройство выпускников вузов в Великобритании как направление научной политики, 2001 г. Ключевые слова: Трудоустройство выпускников. ...

Еще в разделе: (Показать все результаты (>45) - srcc.msu.ru/ )

• University Information System RUSSIA
• D.D.Sokoloff, Magnetic field reversals in a simple model of geodynamo, Problems
• Moss D., Kitchatinov L.L., Sokoloff D., Reversals of the solar dipole, eprint

... Detailed design . ... 5 Message passing tools, independent from base system of message passing . ... 7 Tracing user program and Run-Time System . ... 7.2.5 Controlling internal self-checking Run-Time System mechanisms, functioning during trace accumulation . 7.2.6 Controlling output of additional information when tracing some Run-Time System functions in extended mode . ... 8 Output of informational messages of Run-Time System and error messages . ... Lib-DVM - detailed design (contents) . ...

Еще в разделе: (Показать все результаты (>58) - sp.cs.msu.ru/ )

. Biometrical Journal (DEU) . Biometrics (USA)

Еще в разделе: (Показать все результаты (>2614) - www.sevin.ru/ )

• Фундаментальная экология: Базы данных
• Экологический Форум - Фундаментальная Экология: prada 財布
• Экологический Форум - Фундаментальная Экология: by means of an additional

ALL: visual_statistics.pdf %.pdf: %.tex Makefile lualatex --enable-write18 $ \|^+ \|^%> " visual_statistics.tex | sed -e "s/^\\\/\n# \\\/g" | sed -e "s/^%*> /\n/g" | sed -e "s/^+ //g" > visual_statistics.r plots: pdflatex rrefc_en.tex R CMD Sweave test-Sweave.Rnw pdflatex test-Sweave.tex mv -f test-Sweave.pdf pics/ Rscript visual_statistics.r output: Rscript -e 'source("visual_statistics.r", echo=T)' > visual_statistics.txt

Еще в разделе: (Показать все результаты (>80) - herba.msu.ru/ )

• Index of /shipunov/school/biol_240/en

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... SAI MSU 25 December 2015 . ... Programme . ... МГУ имени М.В.Ломоносова . ... 25 декабря 2015, Москва, ГАИШ МГУ (конференц-зал) . ... Председатель Ю.Н.Гнедин (Пулково, ГАО РАН) . ... Директор ГАИШ МГУ А.М.Черепащук (5 мин.) ... В.М.Липунов (МГУ, ГАИШ) от проекта МАСТЕР . ... А.М.Черепащук (МГУ, ГАИШ) . Кавказская горная обсерватория ГАИШ МГУ . ... И.Д. Караченцев (САО РАН), Н.Н. Емельянов (ГАИШ МГУ), А.Д. Чернин (ГАИШ МГУ) . ... А. Захаров (ИТЭФ) . ... Ю.Н.Ефремов (ГАИШ МГУ) . ...

Еще в разделе: (Показать все результаты (>34) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists
• Успехи Российской Астрофизики 2015 - Контакты
• Успехи Российской Астрофизики 2015

The Status Module is only available in Apache 1.1 and later. The Status module allows a server administrator to find out how well their server is performing. ... The number of children serving requests . ... The status of each child, the number of requests that child has performed and the total number of bytes served by the child (*) . ... Module: mod_status . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>252) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QIntCache Class
• Qt Toolkit - QIntDict member list
• Qt Toolkit - QPtrDict member list

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>37) - brain.bio.msu.ru/ )

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>5) - sun.sai.msu.ru/ )

• Solar Physics Department

... Chair of Theoretical Physics . ... Chair of Quantum Statistics and Field Theory . ... Chair of Optics and Spectroscopy . Chair of Physics of Atomic Nuclei and Quantum Collisions Theory . Chair of Quantum Theory and High-Energy Physics . ... Chair of Computer Methods in Physics . ... Mathematical methods in quantum field theory . ... Introduction . ... Asymptotic methods in statistical physics and quantum field theory . ... Methods of quantum field theory in condensed matter physics . ...

Еще в разделе: (Показать все результаты (>14) - foroff.phys.msu.ru/ )

• Key research directions
• Faculty's Tuition Structure

International School "Frontiers in Numerical Gravitational Astrophysics" . Erice ( Italy ), june 27-july 5, 2008 . ... you and/or your students may be interested in the Course "Frontiers in . Numerical Gravitational Astrophysics" that will be held in Erice (Italy) . ... Univ. of Roma, La Sapienza , Italy . ... Univ. of Texas, Austin, USA . ... FRONTIERS IN NUMERICAL GRAVITATIONAL ASTROPHYSICS| . 2nd Course of the International School on | ... Joshua Barnes (Univ. of Hawaii, USA) . ...

Еще в разделе: (Показать все результаты (>100) - sai.msu.ru/ )

... Электронный журнал "Компьютерная графика и мультимедиа" . ... This project is devoted to create an easy and convenient Matlab based toolbox for investigations of AdaBoost based machine learning algorithms. Download GML AdaBoost Matlab Toolbox 0.4 (From Alexander Vezhnevets homepage at ETH Zurich). Download GML AdaBoost Matlab Toolbox 0.3 . ... GML AdaBoost Matlab Toolbox is set of matlab functions and classes implementing a family of classification algorithms, known as Boosting. ...

Еще в разделе: (Показать все результаты (>52) - graphics.cs.msu.ru/ )

• GML AdaBoost Matlab Toolbox | Graphics and Media Lab
• Age Estimation Using Additional Unlabeled Face Images | Graphics and Media Lab
• Age Estimation Using Additional Unlabeled Face Images | Лаборатория

... Resources . ... info@ecfs.msu.ru . All contacts . ... Eurasian Center . for Food Security . ... Comments: 0 . 15 october 2015 . ... Agriculture and the rural sector in general, is a major determinant of livelihoods in Europe and Central Asia (ECA). ... In Central Asia/Caucasus, most of the poor are in rural areas, where agriculture employs half of the population. ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ... Contacts . ...

Еще в разделе: (Показать все результаты (>59) - ecfs.msu.ru/ )

• Login | ECFS
• Dosov Botir | ECFS
• Parikh Alka | ECFS

... Наши профессиональные области: прикладная статистика, анализ сигналов и контроль процессов биологической и физической природы, история, философия, религия и др. ... Прочие же антропометрические показатели автора крайне заурядны и не представляют абсолютно никакого исследовательского интереса. см. также: Внатуре Арийская генеалогия Мастера . ... CONAN-t - Integrated Computer Series for Frequency Analysis, Control and Automation over Processes in Industrial and Technical Applications . ... Download . ...

Еще в разделе: (Показать все результаты (>5) - www.protein.bio.msu.ru/ )

... Форумы > Аспирантура > Тема . Автор темы Alexey Chernov . Форумы Список тем Новая тема . ... Аспирантская вакансия: байесовский анализ в геномике . ... PhD Student Position in Statistics: "Bayesian Methods for Integrated Genomics" (Switzerland) . ... Strong candidates will have the chance to work on this in later stages of their PhD. ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>45) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | предложение о работе
• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida

... Master Education . Second Education . Additional Education . ... Master programs . ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. 495) 939-23-59, (495) 939-17-73, . Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ... Дополнительное образование: hcs@cmc.msu.ru, 3-й этаж, комната 360, тел. 495) 939-57-93 . ...

Еще в разделе: (Показать все результаты (>126) - hcs.cmc.msu.ru/ )

• Master Education | Магистерское и послевузовское образование Entrance

... Полная версия этой страницы: PhD in Astrophysical Sciences, Princeton, USA . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... The Department of Astrophysical Sciences, Princeton University (USA), . ... and related sciences and carry out original research in observational . ... of Astrophysical Sciences at Princeton include the Apache Point . ... Members of the department have access to state-of-the-art . ... life in the Department see http://www.princeton.edu/astro/graduate/ . ...

Еще в разделе: (Показать все результаты (>109) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > STATISTICA (Excel устроит)
• Студенческий форум Физфака МГУ > Прием в аспирантуру Принстонского Университета
• Прием в аспирантуру Принстонского Университета по специальности Астрофизика -

... Next: Fast probe landing and Up: Client Previous: Photodiode (AFM mode) Contents Index . FemtoScan `` client-program has a number of additional commands to work with during scanning. These commands allow to execute some special operations on microscope control and interface configuration. ... Fast probe landing and retraction . ... Images saving mode . ... Next: Fast probe landing and Up: Client Previous: Photodiode (AFM mode) Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>50) - www.spm.genebee.msu.ru/ )

• Instrument panel
• Additional data acquiring channels
• Format of Legend