NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>4) - scan.sai.msu.ru/ )

• Index of /lk/source

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

Еще в разделе: (Показать все результаты (>4) - depni.sinp.msu.ru/ )

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>31) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And

... Distribution of neutron counting rate near the Earth surface is studied in two directions - to the Earth and from it - according experimental data, obtained in Moscow in 1996. ... We suppose that logarithmically normal distribution describes an input of the Earth crust into the neutron flux. ... Usual periods . ... Full approximation of thermal neutrons distribution near the Earth crust is presented as a sum of two functions - Poison distribution and logarithmically normal distribution. ...

Еще в разделе: (Показать все результаты (>148) - www.kosmofizika.ru/ )

DESCRIPTION OF THE 1d SOLAR EVENT MAP . ... In the case of 1d Map this is 1 day interval around the moment of the solar wind stream start from the Sun. ... This date coincides with central day of the map marked by solid vertical line (in the present example - 8 June, 2000). ... The following phenomena are presented on the map: coronal holes, filaments, solar flares and the distribution of the solar magnetic field on the source surface (2.5 solar radii). ... The filaments are indicated by blue spots. ...

Еще в разделе: (Показать все результаты (>31) - dbserv.sinp.msu.ru/ )

• 3d Map Description
• Catalogue of Space Storms
• SW and GM conditions

Pb-Pb ALICE 19 2013 1 Introduction 1.Ultrarelativistic heavy-ion collisions (HIC) 2. Directed and elliptic flow 3.The purposes of the thesis research 4.Tools for the research: Collider Experiment: the ALICE detector Monte Carlo simulation of HIC: HYDJET++ ·Phenomenological investigation of anisotropic flow in HYDJET++ model ·Summary · Directed flow measurement in experimental ... Flow components: Directed flow at forward rapidity 62 34 Model parameters. ALICE week October 2008 1. ...

Еще в разделе: (Показать все результаты (>64) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/3pi0.ps
• http://lav01.sinp.msu.ru/~vlk/Universality_PVn_PEccn.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/vlk_03.03.15.pdf

... This Software License Agreement ("Agreement") is made and effective by and between ALT Linux Ltd. Developer"), which owns rights for ALT Linux 4.1 Desktop ("Distribution") and you ("Licensee"), end-user of the Distribution. ... The following APPLICATIONS are used and distributed by ALT Linux Ltd. on conditions other than those listed in item 2.2 of the Agreement: . ... ALT Linux Ltd. does not demand reports on using the Distribution from owners of a copy of the Distribution. ... ALT Linux Ltd. ...

Еще в разделе: (Показать все результаты (>452) - uneex.lorien.cs.msu.su/ )

• Preface
• Building Packages for Multiple Architectures and Operating Systems
• Miscellaneous Resources

Buffer phenomenon in mathematical mo dels of natural sciences Mishchenko E. F. Steklov Institute of Mathematics, Russian Academy of Science e-mail: mishch@mi.ras.ru Kolesov A. Yu. Demidov Yaroslavl State University e-mail: kolesov@uniyar.ac.ru Rozov N. Kh. ... 3] Kolesov A.Yu., Mishchenko E.F., and Rozov N.Kh., ... Math., ... 6] Kolesov A.Yu., and Rozov N.Kh., ... The Buffer Phenomenon in Combustion Theory", Dokl. ... 13] Mishchenko E.F., Sadovnichii V.A., Kolesov A.Yu., and Rozov N.Kh., ...

Еще в разделе: (Показать все результаты (>22) - pont2008.cmc.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Vishnevskiy Yury V. , Tikhonov Denis . ... Vogt N. , Vishnevskiy Y.V. , Ivanov A.A. , Vogt J., Vilkov L.V. в журнале Russ. ... Dorofeeva O.V. , Vishnevskiy Y.V. , Moiseeva N.F. в журнале Structural Chemistry , издательство Springer-Verlag (Heidelberg, Germany) , том 17, ? ...

Еще в разделе: (Показать все результаты (>5218) - istina.msu.ru/ )

• Pertsov A.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Ignat'ev A.P. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Montuoro R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Next: Plane tab Up: Client Previous: Connection to a Server Contents Index . Figure 2.4: Scan parameters. STM mode of operation. ... AFM mode of operation. ... All scan parameters can be configures in Parameters window (pic. ... Client part of `` FemtoScan '' software allows to control microscope operating in three different scanning modes - tunneling mode(STM), atomic-force mode (AFM) and resonance atomic-force (RAFM). ... It(Z) tab (STM mode), F(Z) tab (AFM mode), D(Z) tab (RAFM mode). ...

Еще в разделе: (Показать все результаты (>167) - www.spm.genebee.msu.ru/ )

• Plane tab
• Parameters of 3D Images
• DSP board program

... Improvement of Methods and Means of Nonlinear Acoustics for Diagnostics of Concrete of Massive Items, Constructions and Structures . ... For want of distribution of elastic waves in a medium have heterogeneity (located defects, stratification, crack) the performances of an information signal, for example, velocity of distribution, amplitude, spectral component can change the parameters [1]. ... These performances are treated on the specially developed algorithm. ...

Еще в разделе: (Показать все результаты (>380) - acs366.phys.msu.su/ )

• Abstract (Invited)

Evolution as a hard combinatorial problem D. Grigoriev, CNRS, Universitґ de Lille, dmitry.grigoryev@math.univ-lille1.fr e J.Reinitz, Dept.of Statistics, Chicago University, reinitz@galton.uchicago.edu S. Vakulenko, Institute for Mechanical Engineering Problems, Saint Petersburg, vakulenfr@mail.ru A. Weber, Computer Science Department, University of Bonn, weber@cs.uni-bonn.de We consider complexity emergence problem and formation of complex organs. ... The number n >> 1 is the gene number. ...

Еще в разделе: (Показать все результаты (>297) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/199.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/16.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/136.pdf

PHP Manual . ... These functions are intended to work with mhash . This is an interface to the mhash library. mhash supports a wide variety of hash algorithms such as MD5, SHA1, GOST, and many others. ... Compute the MD5 digest and hmac and print it out as hex . php $input = "what do ya want for nothing?"; $hash = mhash (MHASH_MD5, $input); print "The hash is ".bin2hex ($hash)."<br />\n"; $hash = mhash (MHASH_MD5, $input, "Jefe"); print "The hmac is ".bin2hex ($hash)."<br />\n"; ?> ...

Еще в разделе: (Показать все результаты (>718) - oit.cmc.msu.ru/ )

• Retrieving Arguments
• Dealing with a Variable Number of Arguments/Optional Parameters
• Assuring Write Safety for Other Parameters

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Twilight observations with MASS/DIMM B. Safonov Sternberg Astronomical Institute Moscow State University Comprehensive Characterization of Astronomical Sites, 2010 B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 1 / 17 Why observe in twilight with MASS/DIMM? ... ASM includes 3 devices sensitive to background: guider, DIMM and MASS. B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 2 / 17 Background in guider. ...

Еще в разделе: (Показать все результаты (>26) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/Site2010-Summary.pdf
• http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf
• http://site2010.sai.msu.ru/static/doc/VOrlov_site2010.pdf

... MARC Standards Office October 1997 The Application/MARC Content-type Status of this Memo This memo provides information for the Internet community. ... The MARC formats are standards for the representation and communication of bibliographic and related information. ... Introduction The MARC formats are sets of codes and content designators defined for encoding metadata for five types of data: bibliographic, holdings, authority, classification, and community information. ...

Еще в разделе: (Показать все результаты (>48086) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2220.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1741.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1741.txt

... News . ... TLE news . ... Publications on Transient luminous events . ... The UHECRs will be detected through the measurement of the emission in the range between 290 and 430 nm, where some part of Transient Luminous Events (TLEs) emission also appears. ... Luminous event parameters (atmosphere altitude, energy released to radiation, and temporal pro?les) are similar to observed elsewhere parameters of transient luminous events (TLE) of elves, sprites, halo, and gigantic blue jets types. ...

Еще в разделе: (Показать все результаты (>22) - uhecr.sinp.msu.ru/ )

• Global transients in ultraviolet and red-infrared ranges from data of
• UHECR news
• Новости КЛПВЭ

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>74) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/nikitin/posterACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/tobimatsu/tobimatsuk.pdf
• http://acat02.sinp.msu.ru/presentations/morhac/ACAT2002_Morhac_ID142.pdf

... Species distribution . ... According to Pfam database there have been found 487 ETS genes to date, most of which turned out to belong to different species of animal kingdom. ... The following table shows the number of ETS genes present in genomes of most intensively studied species. The number of ETS genes found in genomes of most intensively studied species . ... The following table shows the number of well studied ETS proteins and their distribution among species. ... ETS1, SPI1, SPIB . ...

Еще в разделе: (Показать все результаты (>5489) - monkey.belozersky.msu.ru/ )

• HTH3_species_distribution
• SDPpred
• About authors ot this complex

Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>16) - ocean.phys.msu.ru/ )