.

Еще в разделе: (Показать все результаты (>19) - www.chemport.ru/ )

• "Вакансия standards office manager" - вакансия в разделе "Работа для химиков"

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>15) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

... Heterogeneous networks of multicomputers and the ch_nexus device . ... The startup files for the ch_nexus device are somewhat different, but easy to understand. ... If you have built MPI with ch_nexus device support on multiple platforms, you may not necessarily have the same startup_dir and startup_exe attribute values. ... The startup_count attribute indicates the number of nodes to be used on the SP-2 (in addition to any nodes you may be using on other workstations or multicomputers). ... Центры ...

Еще в разделе: (Показать все результаты (>225) - www.parallel.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>10) - hcs.cmc.msu.ru/ )

• Master program "Network Software" | Магистерское и послевузовское образование

... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...

Еще в разделе: (Показать все результаты (>64) - www.msm.biophys.msu.ru/ )

... TWikiRegistration . To edit pages on this TWikiSite , you must have a registered user name and password. Note: Registered users can change and reset their passwords. ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiRegistration . ...

Еще в разделе: (Показать все результаты (>33320) - dualopt1.cmm.msu.ru/ )

• TWikiRegistration - TWiki - TWiki - (printable)
• CGISessionDriverDBIDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... Форумы > Книжная барахолка > Тема . ... Форумы Список тем Новая тема . ... Продам: Книгу с курса Microsoft - Administering a Microsoft SQL Server 2000 Database . Продам книжку с официального учебного курса Microsoft . M2072 Administering a Microsoft SQL Server 2000 Database на англиском языке за 200$ c дисками за 265$ (4 диска - 2 учебных и 2 установычных для SQL базы) торг. т.926-529-14-13 . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>47) - www.mmonline.ru/ )

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>2544) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~ogion/projects/Evolution_of_sequences/hemn_yp.blast

... Los-Alamos arXiv.org e-Print archive . xxx.itep.ru e-Print archive mirror . Algebraic Topology discussion list . ... Information about conferences . British Topology home page . maintained by Andrew Baker ) . ... Conferences and meetings on Topology and related topics . AMS " Math on the Web " resources: . Mathematics Department Web Servers . ... Zentralblatt MATH Database . ...

Еще в разделе: (Показать все результаты (>37) - higeom.math.msu.su/ )

... A UNIX system has a lot of daemons. a database is the name given to the combination of a program that can manipulate data, together with the data that it acts upon. a record is a set of data about a person or item. Name, telephone number and postcode is an example of such a set. a field is one part of that record; the postcode for example. a delimiter character separates each field from the field preceding it and the field that follows it. ...

Еще в разделе: (Показать все результаты (>61) - comet.sai.msu.ru/ )

• Sysadm
• Digitized Sky Engines
• Miscellaneous

... The University Information System RUSSIA (UIS RUSSIA) has been designed and is maintained as a corporate digital library for research and education in economics and social sciences. ... The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>32) - srcc.msu.ru/ )

• Научно-исследовательский вычислительный центр МГУ
• Laboratory of Informatics
• Структура НИВЦ

Computer tool for gene expression data processing and correlation analysis Anastasia M. Spitsina, Novosibirsk State University, 630090, Novosibirks, 2 Pirogova Str. , anastasia.spitsina@gmail.com Natalya ... databases (BioGPS (http://biogps.org/), GEO NCBI (http://www.ncbi.nlm.nih.gov/geo/)) has accumulated a large body of experimental data obtained using DNA microarrays ... So the aim of this work was to develop and improve own program for data processing and analysis of gene expression. ...

Еще в разделе: (Показать все результаты (>209) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/194.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf

Polikarpov A.A. Explaining Basic Menzerathian Regularity: Dependence of Affixes' Length on the Ordinal Number of their Positions within Words . ... Krylov J. K. Three Laws of Fiction Prosaic Texts Organization (in English) . Kukushkina O.V. Dictionary database "Grammatic Dictionary of Russian by A.A.Zaliznyak" and some results of its research (in Russian) . ... Melnikov G.P. System Typology of Languages: Synthesis of Morphological Classification of Languages with a Stadial One (in Russian) . ...

Еще в разделе: (Показать все результаты (>30) - old.philol.msu.ru/ )

• MSU-LGCLL:: Papers submitted to QUALICO-94

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>105) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_anon.c
• Apache module mod_auth_db

AUTOMATICAL RECONSTRUCTION AND ANALYSIS OF MATHEMATICAL MODEL FOR GENE REGULATORY NETWORKS Akberdin I. , Kazantsev F. , Ree M., Ree N., Timonov V. 1,2, Khlebodarova T.M., Likhoshvai V.A.1 ICG SB RAS, Lavrentyeva ave., ... 86, Novosibirsk, Russia, 630102 Mathematical models of gene regulatory networks are based on the information about the structural and functional organization of gene networks and their dynamic properties that disseminated over hundreds and thousands of scientific papers. ...

Еще в разделе: (Показать все результаты (>87) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc15806/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc15608/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc15822/doc.pdf

Peremennye Zvezdy", . ... Min . ... OGLEII CAR-SC01 2765, 2MASS J11052668-6148368 . ... min . Comm. ... OGLEII CAR-SC01 5494, 2MASS J11051146-6144570 . ... OGLEII CAR-SC01 46493, 2MASS J11055923-6150589 . ... OGLEII CAR-SC01 69423, 2MASS J11055898-6122543 . ... OGLEII CAR-SC01 90562, 2MASS J11055545-6058470 . ... OGLEII CAR-SC01 124846, 2MASS J11062757-6113440 . ... OGLEII CAR-SC01 127687, 2MASS J11062902-6110388 . ... OGLEII CAR-SC02 17, 2MASS J11071601-6152001 . ... MinII = 16.83. ...

Еще в разделе: (Показать все результаты (>1870) - www.astronet.ru/ )

• XWare Team

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>6) - lcl.srcc.msu.ru/ )

LangueDOC . Home . Archives . Languages . ... Movie . Course materials . ... Publications . RUSSIAN . ... In the Spring semester of 2007, the Department of Theoretical and Applied Linguistics of the Philological faculty at Moscow State University started offering elective courses that introduce students to technical topics that are useful, indeed necessary, for documenting endangered languages. ...

Еще в разделе: (Показать все результаты (>203) - www.philol.msu.ru/ )

• 'Русский язык: исторические судьбы и современность' - III Международный

. Scobeltsyn Institute of Nuclear Physics , . Moscow State University , . Experimental High Energy Physics Department . RU-119899, Moscow, Russia . Phone (work) :(+7)(095)939-5881 . Fax :(+7)(095)939-3064 . E-mail : dudko@lev.art.ru . (.ps.gz) . (.ps.gz) , pdf . (.ps.gz) , pdf .

Еще в разделе: (Показать все результаты (>3) - top.sinp.msu.ru/ )