Maximum Parsimony Interpretation of Chromatin Capture Experiments Dirar Homouz, Gang Chen, Andrzej Kudlicki Department of Biochemistry and Molecular Biology Institute for Translational Sciences University of Texas Medical Branch, Galveston, TX, USA The three-dimensional conformation of the genome plays an important role in gene regulation at a wide range of scales, including the distribution of the nucleosomes, the folding of chromatin , as well as chromosomal ...

Еще в разделе: (Показать все результаты (>262) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/237.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/173.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/9.pdf

... We consider now change-points in different components of the frequency spectrum of typical EEG signal. ... Only few change-points in power are found in the initial EEG (unless a prominent alpha rhythm is present). ... Change-points in different frequency components of the EEG . ... Change-points in different types of the EEG alpha activity without substantial gradual changes . ... As can be seen from Fig. 7.3, the program reliably detected the change-points despite of such variety of signal patterns...

Еще в разделе: (Показать все результаты (>76) - brain.bio.msu.ru/ )

• Change-points at different levels of the hierarchy of EEG segmental...
• Other prospects of the change-point based analysis

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>1885) - istina.msu.ru/ )

• Agriculture and Human Values - журнал | ИСТИНА - Интеллектуальная Система
• Science Technology and Human Values - журнал | ИСТИНА - Интеллектуальная
• Kuleshova A.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... 13, Moscow 119992, Russian Federation, e-mail: busarev@sai.msu.ru; 2 Research Institute Crimean Astrophysical Observatory, p/o Nauchnyi, Crimea 334413, Ukraine, e-mail: prok@crao.crimea.ua Summary: We propose a combined method of astronomical investigations of small or distant planets incorporating registration of a set of integral spectra of an object and their frequency analysis. ... An application of the method is shown on example of asteroid 21 Lutetia. ... 6] Busarev V. V. (2002), Solar Sys. ...

Еще в разделе: (Показать все результаты (>224) - selena.sai.msu.ru/ )

• Geophysical Research Abstracts
• Лекции
• Mikhail V. Goryachev

MAKING THE PROFILES . First of all you are expected to load a FITS file ("FILE"-"LOAD"). ... By pressing the middle button you copy the profile from the first profile window to the second one. ... An example: first integral can correspond to the profile of active region and second integral can correspond to the profile of quiet chromospheric region. ... The second profile (which is subtracted from the first one) you extract after clicking on "SUBTRACT"-"MARK QUIET PROFILE" and marking the region. ...

Еще в разделе: (Показать все результаты (>339) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• jo0017
• Jupiter Outer Satellite Orbit Ephemerides.

html head /head body applet code=map_view.class name =red width=250 height=250 archive=map_view.zip codebase= ../ mayscript param name =bgcolor value =#FF7F50 param name =layers_all value = clarc warc2 warc1 sec starc param name =layers_draw value = #clarc #warc2 #warc1 #sec #starc param name =clarc value = draw_layer = ...

Еще в разделе: (Показать все результаты (>54) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/text/text2text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/cursor/cursor1text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/cursor/cursor2text1.htm

... Abstract The fluorescent dyes fluoresceine disodium, eosin Y, rhodamine B, rhodamine 6G and amino-G acid were chosen for the investigation. Their absorption, excitation and fluorescence spectra in aqueous media at different pH values were recorded on a Fluorat-02-Panorama spectrofluorimeter and the maxima of excitation and emission for individual compound were established. ... Moscow University Chemistry Bulletin . 2014, Vol. ... 5, P. 281 . ... Moscow State University, 2002 . ...

Еще в разделе: (Показать все результаты (>740) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 56, No. 5, P. 261 (2015)
• Moscow University Chemistry Bulletin Vol. 50, No. 2, P. 116 (2009)
• An Evaporation Study of C76 by Knudsen Cell Mass Spectrometry

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>3) - www.law.msu.ru/ )

VALUES, CANONS, PRICES Text as Means of Cultural Exchange VII Fulbright Summer School in the Humanities Moscow, June 22-30, 2004 Tuesday, June 22 Opening (MSU, 1 Humanities, 652) The Culture of Dialogue in the World Today (Discussion with participation of V. Pozner & S. Mailloux) Wednesday, June 23 Steven Mailloux Values and Valuations. U.S. Cultural Studies and Rhetorical Hermeneutics Elena Trubina Values Shared and Contested. ... Discussion) Monday, June 28 Steven Mailloux Values and Valuations. ...

Еще в разделе: (Показать все результаты (>274) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~discours/images/stories/Documents/essay.doc
• http://www.philol.msu.ru/~summer/images/stories/publ/2004_contents_eng
• http://www.philol.msu.ru/~summer/images/stories/publ/summary_04.doc

... The modulation of wavevector of surface plasmons leads to enhancement of transversal magneto-optical Kerr effect ( TMOKE ), which has been recently observed in nickel nanogratings,3 in ferrite-garnetnoble metal grating4 or in Au/Co/Au multilayer structures.5 These magnetoplasmonic structures support both magnetooptical and plasmonic properties and allow using TMOKE as a probing tool for ... This difference from the Bragg plasmons proves a mixed origin of these plasmonic excitations. ...

Еще в разделе: (Показать все результаты (>70) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/jap111_07a944_2012.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jetplett103_46_2016.pdf
• http://nanolab.phys.msu.ru/sites/default/files/pre80_046602_2009.pdf

Форум МГУ Главная Помощь > . ... BB-коды . ... Делает выделенный текст полужирным, наклонным, подчеркнутым или зачеркнутым. Пример: . Это [B]полужирный[/B] текст. ... Вывод: . ... Изменяет цвет, шриф или размер выделенного текста. ... Создать ссылку из выделенного текста. ... URL]http://www.example.com[/URL] . ... Делает выделенный текст ссылкой на интернет-страницу или адрес e-mail. ... Показывает картинку, используя выделенный текст как URL . ... Увеличивает отступ выделенного текста. ...

Еще в разделе: (Показать все результаты (>26) - osk.msu.ru/ )

This module provides the ability to set environment variables based upon attributes of the request. ... The mod_setenvif module allows you to set environment variables according to whether different aspects of the request match regular expressions you specify. ... BrowserMatch . ... Syntax: BrowserMatch regex env-variable [= value ] [ env-variable [= value ]] .. ... Module: mod_setenvif . ... The BrowserMatch directive defines environment variables based on the User-Agent HTTP request header field. ...

Еще в разделе: (Показать все результаты (>97) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache directives
• Apache module mod_imap
• Apache module mod_headers

... x264 is an open source codec of standard MPEG4 AVC/H.264, developed by programmers from all over the world. ... Accumulated during previous frames' compressions statistic is actively used by codec to improve effectiveness of adaptive models. ... These parameters are used only before encoding start, so, our improvements are more significant for short sequences. ... 3 Results of codec x264 modification on "flower" sequence . ... 5 Results of codec x264 modification on "flower" sequence, low bitrates ....

Еще в разделе: (Показать все результаты (>267) - graphics.cs.msu.ru/ )

• x264 codec improvement | Лаборатория компьютерной графики и мультимедиа
• Automatic Left-Right Channel Swap Detection | Лаборатория компьютерной графики
• Automatic Left-Right Channel Swap Detection | Graphics and Media Lab

... IPI program works with group of sounding curves (from 1 to 100) in one data file. ... If Type of Array is =+3 or +4, then: 7 line : Name of VES (from 1 to 8 symbols) 8 line : number of distances for this VES . 9 line : dV values (in mV or V) 10 line : I values (in mA or A) Examples of *.dtg file : Example 1 for stabilized current AMN array Bilibino-90, VES from 24.5 to 43.0. 1 2 lines - description of data profile 4 1 0 17 1 -3 S { VES number , KeyIP, ?ax.nAB, ...

Еще в разделе: (Показать все результаты (>82) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/84.pdf
• http://geophys.geol.msu.ru/STUDY/manual/ie2.doc
• http://geophys.geol.msu.ru/berd/IPSE717.pdf

... October 8, 1996 . ROSAT Explores the X-Ray Sky . ... Explanation: Launched in 1990, the orbiting ROSAT observatory explored the Universe by viewing the entire sky in x-rays - photons with about 1,000 times more energy than visible light . This ROSAT survey produced the sharpest, most sensitive image of the x-ray sky to date. The all-sky image is shown with the plane of our Milky Way Galaxy running horizontally through the center. ... About APOD | ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: August 6, 1998 - Infrared Horsehead
• APOD: May 24, 1996 - In the Center of 30 Doradus
• APOD: 2000 March 12 - Supernova 1994D and the Unexpected Universe

... All rights reserved 0006-3509/96 $24.00+ .00 PH: 80006-3509(96)00171-8 TYPES OF NON-LINEAR BEHAVIOUR OF THE SYSTEM OF ION TRANSFER ACROSS THE MEMBRANE ON EXPOSURE TO A WEAK ELECTRIC FIELD* · 1 · T. Yu. ... L.- x Fig. ... Changes in the concentration of protons in response to external periodic perturbation external action A = 0.003 and critical frequency frequencies, periodic oscillations take place, x and potassium ions y in the near-membrane layer by a weak electric field. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3334.pdf

... Строчные теги логического форматирования: <em>, <strong>, [<q>, <span>]. ... Взаимоотношения между </p> и блоковыми тегами. ... a href = 2.html Two /a /body /noframes Теги заголовка ( head ) --- Тег meta name /http-equiv content --- meta name = Author|Description|Keywords|Creator|Expires|Address content= ... --- meta http-equiv= Content- Type content= text/html; charset=windows-1251 --- Запись о стиле !DOCTYPE HTML PUBLIC \ -//W3C//DTD HTML ...

Еще в разделе: (Показать все результаты (>259) - herba.msu.ru/ )

• http://herba.msu.ru/shipunov/school/biol_240/en/r/pleiad.r
• http://herba.msu.ru/shipunov/school/biol_240/en/r/mice.r
• New Page 1

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Supernova Gallery The purpose of the Bright Supernovae web pages is to provide a place where people can find reference images of Supernovae. ... This is an RGB color image of Supernova 2003gs in NGC 936 Credit: Pablo Canadia . Used by permission. (click on image for full resolution) . ... This is an LRGB color image of Supernova 2003cg in NGC 3169 Credit: Pollux observatory . ... Credit: Nick Suntzeff Used by permission. (click on image for full resolution) . ... Credit: AURA/NOAO Image Library . ...

Еще в разделе: (Показать все результаты (>156) - www.rochesterastronomy.org/ )

• Nova in M31 2000 4
• SN1989B in M66

Gauss-Laguerre Keypoints Descriptors for Color Images Andrey S. Krylov and Dmitry V. Sorokin Laboratory of Mathematical Methods of Image Processing, Faculty of Computational Mathematics and Cybernetics, Lomonosov Moscow State University, http://imaging.cs.msu.ru Email: {kryl, dsorokin}@cs.msu.ru Abstract--Keypoints descriptors construction algorithm for color images is introduced. ... V. C ONCLUSION Keypoints descriptors construction algorithm for color images was introduced. ...

Еще в разделе: (Показать все результаты (>266) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2009.ICIP.Nasonov_Krylov.RinMetr.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• http://imaging.cs.msu.ru/pub/2009.Graphicon.Krylov_Nasonov.IntComb.en.pdf