Euro-Asian Astronomical Society . The International Astronomy Olympiad . The International Olympiad of Euro-Asian Astronomical Society was founded on June, 7, 1996, as an annual astronomy competition for high-school students. ... Founding Statutes of the International Astronomy Olympiad Ratified 07.06.1996 . ... Preliminary International Astronomy Olympiad 1990 . Preliminary International Astronomy Olympiad 1991 . ... of the International Olympiad of Euro-Asian Astronomical Society, . ...

Еще в разделе: (Показать все результаты (>48) - www.issp.ac.ru/ )

• II International Olympiad of Euro-Asian Astronomical Society
• International Olympiad of Euro-Asian Astronomical Society (In Russian)
• II International Olympiad of Euro-Asian Astronomical Society (in Russian Win

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

... This document provides a set of guidelines for the administration and operation of public Network Information Center (NIC) databases. The purpose is to formalize procedures for the responsible handling of the personal and organizational information maintained by NICs in publically accessible databases, and to improve the accuracy and accessibility of such data where appropriate. ... The first part contains recommendations for preventing unauthorized disclosure of information in NIC databases. ...

Еще в разделе: (Показать все результаты (>18261) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/app-text/referencer/
• Index of /pub/gentoo-portage/app-text/referencer/files/
• Index of /pub/gentoo-portage/sci-libs/blas-reference/

... Available at http://www.hike.te.chiba-u.ac.jp/ikeda/CIE/publ/abst/15-2-86.html . ... Available at http://www.w3.org/TR/REC-CSS1-961217.html. ... HTML 4.0 Specification", D. Raggett, A. Le Hors, I. Jacobs, 8 July 1997. ... Available at ftp://ftp.internic.net/rfc/rfc1700.txt. ... Available at ftp://ds.internic.net/rfc/rfc1808.txt . ... Available at ftp://ds.internic.net/rfc/rfc2070.txt . ... Available at ftp://ds.internic.net/rfc/rfc2119.txt . ... Available at ftp://ds.internic.net/rfc/rfc2318.txt . ...

Еще в разделе: (Показать все результаты (>957) - crydee.sai.msu.ru/ )

• SGML reference information for HTML
• Long description for the illustration of reference vs. device pixel
• HTML 4.0 Specification References

Next: Interface Repository Up: ORB Previous: ORB Initialization . The ORB offers two functions for obtaining object references for the interface repository, the implementation repository, and the naming service. Here is an example that shows how to obtain a reference for the interface repository using resolve_initial_references() : . int main (int argc, char *argv[]) { CORBA::ORB_var orb = CORBA::ORB_init (argc, argv, "mico-local-orb"); .. ...

Еще в разделе: (Показать все результаты (>452) - rtm-cs.sinp.msu.ru/ )

• Reference Counting
• Stringified Object References
• References

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>11) - comphep.sinp.msu.ru/ )

• docs [CompHEP]
• download:main [CompHEP]

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Function Name Cross Reference . Up: C++ Bindings on all MPI Classes Next: Index Previous: Inter-language Operability . Since some of the C++ bindings have slightly different names than their C and Fortran counterparts, this section maps each language neutral MPI-1 name to its corresponding C++ binding. ... Where MPI-1 names have been deprecated, the < none > keyword is used in the ``Member name'' column to indicate that this function is supported with a new name (see Annex Language Binding ). ...

Еще в разделе: (Показать все результаты (>241) - www.parallel.ru/ )

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Short Reference Image Quality Estimation Using Modified Angular Edge Coherence . ...

Еще в разделе: (Показать все результаты (>260) - graphics.cs.msu.ru/ )

• Saliency Map Estimation | Graphics and Media Lab
• GML AdaBoost Matlab Toolbox | Лаборатория компьютерной графики и мультимедиа
• Road monitoring | Graphics and Media Lab

... April 12, 1999 . Nearby Spiral Galaxy NGC 4945 . Credit: 2P2 Team , WFI , MPG/ESO 2.2-m Telescope , La Silla , ESO . Explanation: For such a close galaxy, NGC 4945 is easy to miss. NGC 4945 is a spiral galaxy in the Centaurus Group of galaxies, located only six times farther away than the prominent Andromeda Galaxy . ... Therefore galaxy-gazers searching the southern constellation of Centaurus need a telescope to see it. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>73) - www.arcetri.astro.it/ )

• APOD: December 6, 1999 - M83: The Southern Pinwheel Galaxy from VLT
• APOD: December 30, 1998 - Supernova 1994D and the Unexpected Universe
• APOD: 2000 March 12 - Supernova 1994D and the Unexpected Universe

... RAMPA - CASE for portable parallel programs development?. ... N.A. Konovalov, V.A. Krukov, S.N. Mihailov and A.A. Pogrebtsov. Fortran DVM - a Language for Portable Parallel Program Development? ... Fortran DVM - A Language for the Development of Portable Parallel Programs. ... Development of Portable Program System for Modeling Neutron-Physical Processes in Nuclear Reactor on Parallel Computers. ... C-DVM-A Language for the Development of Portable Parallel Programs. ...

Еще в разделе: (Показать все результаты (>125) - sp.cs.msu.ru/ )

• Специальный курс Методы управления транзакциями в современных СУБД
• Fortran DVM language description
• Кузнецов Сергей Дмитриевич

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>29) - ecoinformatica.srcc.msu.ru/ )

... LIST OF PUBLICATIONS (In English) . ... Proceedings of the II International Seminar on high energy physics and quantum field theory (1979, Protvino) . ... Proceedings of the XII International Seminar on high energy physics and quantum field theory, Protvino (Nauka, 1990) . ... Proceedings of the XIII International Seminar on high energy physics and quantum field theory, Protvino (Nauka, 1991) . ... Proceedings of the XV International Workshop on high energy physics and field theory (Protvino, 1995) ...

Еще в разделе: (Показать все результаты (>564) - theory.sinp.msu.ru/ )

• No Title
• LanHEP
• References

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>518) - astro.uni-altai.ru/ )

• Обзоры препринтов astro-ph

... of Moscow State University Official Website . ... Faculty of Mechanics and Mathematics of Moscow State University, Russian Academy of Technical Sciences, Russian Academy of Natural Sciences, Council on Cybernetics of Russian Academy of Science, and Moscow Scientific Center for Culture and Information Technology organize the X International Conference "Intelligent Systems and Computer Science" at the Faculty of Mechanics and Mathematics of Moscow State University from December 05 to December 10, 2011...

Еще в разделе: (Показать все результаты (>101) - www.intsys.msu.ru/ )

• Интеллектуальные системы :: Наука :: :: V international congress on
• Intelligent Systems :: Research :: Search in Databases
• Intelligent Systems :: Staff :: Gasanov Elyar Eldarovich

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... Abstract Submission . ... III International Conference on Heterocyclic Chemistry, . in Honor of the late Professor A.N. Kost's 95th Anniversary . ... To submit an abstract you need to send an e-mail to the address Kost_2010@mail.ru to Yurovskaya Marina Abramovna with attached *.doc files. All accepted abstracts will be published in the Proceedings volume. For the rules how to design the abstracts see below. ... Abstracts without mark will be considered lecture. ...

Еще в разделе: (Показать все результаты (>399) - chem.msu.ru/ )

• Registration fees. Russian XV International conference on chemical
• Photochemistry sites on INTERNET
• Sections and Topics. Russian XV International conference on chemical

About ACLS http://www.acls.org/morabout.htm . ... ACLS Publications http://www.acls.org/aclspubs.htm . ... Guidelines for the Translation of Social Science Texts http://www.acls.org/sstp_guidelines.pdf is the product of the Social Science Translation Project (SSTP), which brought together a group of translators, editors, and social scientists to discuss problems arising from the translation of a variety of texts that employ social-scientific concepts. ... http://www.acls.org/sstp_guidelines.pdf , . ...

Еще в разделе: (Показать все результаты (>166) - www.prof.msu.ru/ )

• GLOBAL EDUCATION FOR NEW ECONOMY
• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• Internationalizing Education In Barnaul State Pedagogical University

A singleton object of this class manages the access control database. ... getReason ObjectMethod getReason () -> $string . ObjectMethod checkAccessPermission ($action,$user,$text,$meta,$topic,$web) -> $boolean . ... Check if user is allowed to access topic . ... Settings in $meta override * Set settings in plain text. $topic - Topic name to check, e.g. 'SomeTopic' *undef to check web perms only) . web - Web, e.g. 'Know' If the check fails, the reason can be recoveered using getReason. ...

Еще в разделе: (Показать все результаты (>24407) - dualopt1.cmm.msu.ru/ )

• AlexKopylov - Main - TWiki
• AndreyGolovin - Main - TWiki
• ElenaZavyalova - Main - TWiki

. Lomonosov Moscow State University Faculty of History . Electronic Recourses Library . Русская версия . Electronic texts (in Russian) . Databases (in Russian) . Digital sources and Palaeography . Links for reference books (in Russian) . Art and History Museums around the World (in English) . Revised - September, 26th, 2009 . Lomonosov Moscow State University . Association "Istoria and Comp'uter" - the Russain branch of the AHC

Еще в разделе: (Показать все результаты (>264) - hist.msu.ru/ )

• Справочники по истории в Интернете
• Project "The Labour Relations Evolution in Russian Industries"
• Базы данных