... Motivations and Problems of Studying Time . ... Deepening of special scientific concepts . ... Measuring the age of natural systems . ... About relative concept of time . ... Problems of the typological concept of time . ... Biological Time, its Organization, Hierarchy and Presentation by Complex Values . ... Mathematical Temporal Constructions . ... Earth Sciences . ... Time As Variability of Natural Systems: Ways of Quantitative Description of Changes and Creation of Changes by Substantial Flows ....

Еще в разделе: (Показать все результаты (>430) - chronos.msu.ru/ )

• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and
• Табл. 1. Характер лимитирования при потенциальном ограничении роста альгоценоза
• MATHEMATICAL BIOLOGY

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>223) - www.genebee.msu.ru/ )

• GEA :: Gene Expression Analysis
• INTAS :: Global and Local Protein Matching
• Biochemistry (Moscow), Vol

... Therefore two component approach is needed (GVDM /soft component/+QCD /hard component/). ... In the models with "soft-wall" square of meson mass is proportional to the number of meson . ... 14 Energy dependence of cross section (soft component) and hard component For GVDM (soft) component the energy dependence was chosen in the Regge-type form 1.29 s p ( s ) = 114 * + s 1600 0.06 . ... F2 ( x, Q 2 ) Particle Data Group, 2007 Blue line is the soft (GVDM) component. ...

Еще в разделе: (Показать все результаты (>141) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/240809/Ilina.pdf
• http://nuclphys.sinp.msu.ru/conf/epp10/Mokeev.pdf

... История кафедры . ... младших курсов . ... Уважаемые студенты 1-го, 2-го и 3-го курсов! ... Семинар кафедры проходит по пятницам в 15.20 в комн. ... а также на стендах кафедры на 2-м и 4-м этажах. Информацию о более ранних событиях см. в разделе "Жизнь кафедры" . ... 119991, Москва, Ленинские горы, д.1, стр.2, МГУ имени М.В.Ломоносова, физический факультет, кафедра фотоники и физики микроволн . ...

Еще в разделе: (Показать все результаты (>2) - photonics.phys.msu.ru/ )

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>112) - www.intsys.msu.ru/ )

• Интеллектуальные системы :: Наука :: :: V international congress on

Combination of high resolution mass -spectrometry (FT-ICR) and nuclear magnetic resonance ( NMR ) for analysis of mumijo (shilajit) Gleb Vladimirov1, Anton Grigoryev1,5, Alexey Kononikhin1,2, Norbert Hertkorn4, Andrey Konstantinov3, Irina Perminova3, Igor Popov1.2, Eugene Nikolaev1,2 Institute For Energy Problems of Chemical Physics RAS, Moscow , Russia Institute of Biochemical Physics RAS, Moscow , Russia 3 Lomonosov Moscow State University, ...

Еще в разделе: (Показать все результаты (>151) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss-14/docs/IHSS-14-draft-conclusions-Sep-18.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-karpiouk-synthesis.pdf

Fortran-DVM Compiler . Detailed design . ... 3.1 Parsing . 3.2 Transforming parse tree . 3.3 Generating code in Fortran 77 . ... 4.2 Symbol and Type table . ... This report presents the detailed description of the Fortran-DVM (FDVM) compiler implementation. ... The input to the compiler is source code in Fortran DVM or HPF-DVM language. ... It is designed as an open C++ class library that provides a set of parsers, a structured parse tree, a symbol and type tables for a user. ... dvm.cpp . ...

Еще в разделе: (Показать все результаты (>144) - sp.cs.msu.ru/ )

• DVM-system. Goals and structure
• Fabrik - A Visual Programming Environment
• Design Principles Behind Smalltalk

Space Weather . ... Space weather . ... 3D magnetosphere . ... Data . ... Solar wind density . cm -3 , [0 - 100] . Solar wind velocity . km/s, [0 - 2000] . ... Three-dimensional magnetosphere structure . ... 2012 Space Monitoring Data Center . ...

Еще в разделе: (Показать все результаты (>10) - swx.sinp.msu.ru/ )

DISC OURSE FUNC TIONS OF POSSESS IVE PRONO UNS IN R USSIAN Two main functions of possessive pronouns (PossPrn) in Russian are identifying the possessor ( `my dog') and filling an argument slot of a noun ( `her return'). Sometimes possessive pronouns, especially the reflexive ones, bear additional components of meaning (see [Paducheva 1983: 6-7]). This paper focuses on cases when a PossPrn doesn't have such additional components, and yet the possessor is unambiguously determined by the context. ...

Еще в разделе: (Показать все результаты (>336) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/fdsl/abstracts/jablonska.pdf
• http://www.philol.msu.ru/~otipl/new/mscl/2008/abstracts/knyazev-perkova.pdf
• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/krivn_1.doc

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Discovery of multi-component portfolio strategies with continuous tuning to the changing market micro-regimes using input-dependent boosting . ...

Еще в разделе: (Показать все результаты (>356) - graphics.cs.msu.ru/ )

• GML LidarK Library | Graphics and Media Lab
• Reconstruction of structure and texture of city building facades. | Graphics
• GML LidarK Library | Лаборатория компьютерной графики и мультимедиа

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>35) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>164) - www.enzyme.chem.msu.ru/ )

• About Lab
• Dr. Irina G. Gazaryan

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Czernik 23
• SAI OCL Catalog Czernik 21
• SAI OCL Catalog Berkeley 97

... Scientific Laboratories . ... Main Science and education Scientific Laboratories Laboratory of solid-state lasers and coherent spectroscopy . ... The first experiments in the laboratory of solid-state lasers and coherent spectroscopy were done in 1974-1975 years. ... In 1980, the laboratory began more complex experiments on the base of picosecond lasers, namely experiments realizing nonstationary picosecond CARS of molecular gases (CARS-coherent antiStokes Raman scattering). ...

Еще в разделе: (Показать все результаты (>116) - ofvp.phys.msu.ru/ )

The first major global tomographic study was made by Professor Dziewonski in early 70's. The idea of this study was that the travel time anomalies observed for many ray paths, criss-crossing the Earth between various points near the Earth's surface and reaching different depths in its interior, could be resolved formally into a three-dimensional (3-D) model. ... How to use Harvard's 3-D Earth models? Now, you can download source codes in order to use Harvard's recent Earth models. ...

Еще в разделе: (Показать все результаты (>804) - geo.web.ru/ )

• Новое учебное пособие по тектонофизике: ВВЕДЕНИЕ В ТЕКТОНОФИЗИКУ, Авторы: М. А.
• Bragg W. L. "The structure of silicates" - Все о Геологии (geo.web.ru)
• Trusov Sergey's homepage The influence of boundary layer effects on the melt

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

Chapter€а5.€а Getting images into GIMP . ... Image types . ... Working with Images . ... There are three possible modes: RGB, grayscale, and indexed. ... Because every humanly distinguishable color can be represented as a combination of red, green, and blue, RGB images are full-color. ... Essentially the difference between a grayscale image and an RGB image is the number of тАЬ color channels тАЭ: a grayscale image has one; an RGB image has three. ... A color image in RGB mode with an Alpha channel. ...

Еще в разделе: (Показать все результаты (>467) - uneex.lorien.cs.msu.su/ )

• mod_auth_anon - Apache HTTP Server
• What's in a package?
• mod_access - Apache HTTP Server

... Thus, the development of a method of synthesis of signals of finite duration, optimal in the sense of maximum concentration of energy in specified frequency ranges, is the actual problem. ... Erik Larsen, Ronald M. Aarts, "Audio Bandwidth Extension: Application of Psychoacoustics, Signal Processing and Loudspeaker Design", John Wiley & Sons, ISBN: 0-470-85864-8, September 2004. ... Time-frequency decomposition, 2. ... Shaping of the energy spectrum envelope of high-frequency content, 4. ...

Еще в разделе: (Показать все результаты (>607) - imaging.cmc.msu.ru/ )

• Ringing analysis | Laboratory of Mathematical Methods of Image Processing
• View publication | Laboratory of Mathematical Methods of Image Processing

... M.V.Lomonosov Moscow State University . ... Structure . ... Research Centers . ... Physicists from Moscow State Univ. in collaboration with researchers from IKI RAS first constructed a two-dimensional quasi-adiabatic model of a thin current sheet in the magnetotail based on its longitudinal inhomogeneity. ... Popov, D.C. Delcourt, A. A. Petrukovich, and L. M. Zelenyi, Antisunward structure of thin current sheets in the Earth's magnetotail: implications of quasi-adiabatic theory, J. Geophys. ...

Еще в разделе: (Показать все результаты (>388) - phys.msu.ru/ )

• Contacts
• Обеспечение учебного и научного процессов на факультете лицензионным
• Как получить копию лицензионного пакета LabView для использования в

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>164) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/028e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/091e.pdf