... ИСТОРИЯ ГАИШ - хроника, музей, персоналии, мемуары, периодика . Сайт "HERITAGE - астрономия, астрономическое образование с сохранением традиций" ориентирован на студентов 1 и 2-го курсов астрономического отделения физического факультета МГУ и отражает ранением традиций" ориентирован на студентов 1 и 2-го курсов астрономического отделения физического факультета МГУ и отражает работу, проводимую сотрудниками ГАИШ МГУ и физического факультета МГУ по расширению астрономического образования студентов. ...
Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "200034_s_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . ...
You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...
... Институт русского языка и культуры - учебное подразделение љ МГУ имени М.В.Ломоносова , которое занимается преподаванием русского языка как иностранного и неродного,љподготовкой иностранных граждан к обучению на профильных факультетах МГУ и в других высших учебных заведениях России, повышением квалификации и переподготовкой специалистов по профилю РКИ, тестированием, а также распространением и продвижением русского языка во всем мире. ... Институт русского языка и культуры МГУ имени М. В. Ломоносова...
... 1984: Department of Structural and Applied Linguistics, Philological Faculty, Moscow State University; M.A. earned in June 1984. ... 2003, Habilitation report: Analiz diskursa v kognitivnoj perspektive (Discourse analysis in a cognitive perspective) [ pdf ]. Institute of Linguistics RAN. 90 pp.. ... Cognitive Lingustics Association (since 1997). ... Cognitive Linguistics (Berlin, Mouton de Gruyter), 1997 ? ... Popularization of the advances in linguistics and cognitive science on Russian TV. ...
... Seminar archive . ... Type Ia Supernovae (SNe Ia) have an important role to measure a distance to an anonymous galaxy because they have a good correlation of the decline rates of the light curves with the absolute luminosity. ... First, super-Chandrasekhar SNe which have extremely high luminosity, slow decline rate of the light curves, slow expansion velocity and strong carbon features. ... As another example of diversity of SNe Ia, I would like also to introduce Type Iax SNe. ... All seminars: . ...
... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...
... Другие названия журнала: Acta Cryst , Acta Crystallographica A: Foundations of Crystallography , Acta crystallographica A: Foundation of Crystallography показать полностью.. ... Section A, Foundations of crystallography . ... Eremina T.A. , Eremin N.N. в журнале Acta Crystallographica Section A: Foundations of Crystallography , издательство Blackwell Publishing Inc. ... в журнале Acta Crystallographica Section A: Foundations of Crystallography , издательство Blackwell Publishing Inc. ...
The development of the method for the analysis of proteomics data Dmitry S. Ischenko, V. Popkov Moscow Institute of Physics and Technology, Dolgoprudny, Russia, ischenko.dmitry@gmail.com Dmitry G. Alexeev Scientific-Research Institute of Physicochemical medicine, Moscow, Russia, exappeal@gmail.com In the analysis of mass spectrometry data of unannotated sample the problem is in an adequate evaluation of the results. The question is: what to choose as a protein database for searching? ...
[
Текст
]
Ссылки http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/194.pdf -- 87.4 Кб -- 03.06.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Article 2 of the statutes of the Humboldt Foundation ) 3 http :// www.humboldt-foundation.de Research Fellowships and Research Awards granted by the Alexander von Humboldt Foundation Programmes for Programmes for scientists and scholars scientists and scholars from abroad from abroad Programmes for Programmes for scientists and scholars scientists and ...
[
Текст
]
Ссылки http://phys.msu.su/rus/research/conferences/more-2005/zadkov-MORE_AvH.pdf -- 340.2 Кб -- 31.07.2008
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/research/conferences/more-2005/zadkov-MORE_AvH.pdf -- 340.2 Кб -- 31.07.2008
[
Текст
]
Ссылки http://phys.msu.ru/rus/research/conferences/more-2005/zadkov-MORE_AvH.pdf -- 340.2 Кб -- 31.07.2008 Похожие документы
... All the galaxies are divided into 4 groups depending on the environment type; every subsample contains more than 10 galaxies. ... An effect of environments is seen both for the nuclei and for the bulges: if we consider the clusters (Virgo and Ursa Ma jor) and group centers as dense environments and the field and group periphery as sparse environments, then in the dense environments the stellar populations of S0s are in average older by 45 Gyr than in the sparse ones. ...
... 34, Database issue doi:10.1093/nar/gkj102 From genomics to chemical genomics: new developments in KEGG 5 Minoru Kanehisa1,2,*, Susumu Goto1, Masahiro Hattori1, Kiyoko F. Aoki-Kinoshita1, Masumi Itoh1, Shuichi Kawashima2, Toshiaki Katayama2, Michihiro Araki2 and Mika Hirakawa1,3 1 2 Bioinformatics Center, Institute for Chemical Research, Kyoto University, Uji, Kyoto 611-0011, Japan, Human Genome Center, Institute of Medical Science, University of Tokyo, ... 34, Database issue D355 Table 1. ...
... on the project . ... Laws on labour relations . Statistical and reference materials . Publications of the end of 19th - first three decades of 20th centuries . Publications of 1930s-1980s . Publications of the end of 20th - the beginnig of 21th centuries . Papers on the state regulation of labour relations . Bibliography on labour relations . ... Digitised images of archival and other historical documents . Electronic versions of archival and other documents . ...
THE PROBLEMS IN EXPERIMENTAL FOUNDATION OF CAUSAL MECHANICS . A. G. Parkhomov . Causal mechanics developed by N.A.Kozyrev (1958,1968) and based on the concept of active properties of time has been a subject for emotional scientific discussions for four decades running. ... Equally important is that causal mechanics is consistent with both classic and quantum mechanics. ... However, the experimental foundation of causal mechanics is considered inadequate by scientific community. ...
... Los-Alamos arXiv.org e-Print archive . xxx.itep.ru e-Print archive mirror . Algebraic Topology discussion list . ... Information about conferences . British Topology home page . maintained by Andrew Baker ) . ... Conferences and meetings on Topology and related topics . AMS " Math on the Web " resources: . Mathematics Department Web Servers . ... Zentralblatt MATH Database . ...
. Home Sponsors . 09 / 04 / 2016 . QFTHEP . Home . News . Bulletins . Programme . QFTHEP Poster . Sponsors . Proceedings . Archive . QFTHEP'2013 . QFTHEP'2011 . QFTHEP'2010 . QFTHEP'2004 . QFTHEP'2003 . QFTHEP'2001 . QFTHEP'2000 . QFTHEP'1999 . QFTHEP'1997 . User Menu . Login/Logout . National Intellectual Development Foundation at MSU . Skobeltsyn Institute of Nuclear Physics, MSU . Samara State University . Russian Foundation for Basic Research . Dynasty Foundation by Dmitry Zimin .
... Bernhard Thalheim. ... OLTP-OLAP, play-out play-in . ... play-out . ... ER-, , § sr ec i = ,i , , {o}, {o} |= § h0 (s) = f h undef f 0, s = N U LL f (s) undef , s = N U LL f (s) (s) = , sum null 0 null 1 = sr ec 0,h 0 Id ,+ sum null undef = sr ec 0,h undef Id ,+ ; ,+ count = sr ec 0,h0 ,+ 1 count undef 1 = sr ec 0,h undef 1 SQL-, sum null 0 . ... CMO-), CMO- ( , 320 . ... Berlin: Springer, 2003. ... 5] Lenz H.-J., Thalheim B. Olap databases and aggregation functions // In 13th SSDBM 2001 (2001). ...
[
Текст
]
Ссылки http://www.intsys.msu.ru/magazine/archive/v10(1-4)/talheim-303-342.pdf -- 542.1 Кб -- 20.06.2007 Похожие документы