The old base model for VES data interpretation was horizontally-layered medium. We consider as the new base model ( fig.1 ) a combination of horizontally-layered structure (HLS) , deep inhomogeneities (DI) (3-4 on fig.1) and nearsurface inhomogeneities - NSI (1-2 on fig.1). TES field technology includes the next rules: . ... In turn AO max depends on depth of investigation h max . ... These effects depends also on the fact: is this dipole group or single electrode moveable or unmoveable. ...

Еще в разделе: (Показать все результаты (>57) - geophys.geol.msu.ru/ )

• Geophysical department at Moscow University
• Researchs

fitshdr - FITS-file headers manipulation tool fitshdr [options] [FITSfile_name] . ... fitshdr [options] --edit FITSfile_name . ... If You want to modify headers of FITSFILE using new FITS-header lines from HEADER file (or from stdin), You have to use this option (You can skip this option, if -H or --header option is used). ... Empty header lines are not displayed (in 'dump' mode only). --line-offsets . ... In 'dump' mode: file offset will be displayed for each header line. --no-line-offsets . ...

Еще в разделе: (Показать все результаты (>343) - lnfm1.sai.msu.ru/ )

• Eugene Trunkovsky
• FITShdr: FITS header viewer/editor
• ...Some useful software links...

Name Last modified Size Description . Parent Directory - top.htm 01-Nov-2010 03:19 305 . Apache Server at genphys.phys.msu.su Port 80

Еще в разделе: (Показать все результаты (>25) - genphys.phys.msu.su/ )

... 2015-12-17 12:35 . 1.2K . ...

Еще в разделе: (Показать все результаты (>234) - herba.msu.ru/ )

• Index of /shipunov/school/biol_448/nd_keys/nd_compositae/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_plant_families/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_labiatae/includes

. [ Войти ] . Главная -> Фильмы -> Parrot Sketch Not Included: .. Пользователи . Демо . Деньги . Фильмы . Форум . Parrot Sketch Not Included: Twenty Years of Monty Python . Неизвестные Скетчи Монти Пайтон . Великобритания 1989 . отметить . Комедия . Ian MacNaughton . Steve Martin . Graham Chapman . John Cleese . Terry Gilliam . Eric Idle . Terry Jones . Michael Palin . Carol Cleveland . Connie Booth . Basil Tang . Marjorie Wilde . The Fred Tomlinson Singers .

Еще в разделе: (Показать все результаты (>421) - kinfo.ru/ )

• *batteries not included - Фильмы - Kinfo.ru
• Too Hot to Handle - Фильмы - Kinfo.ru
• The Chelsea Handler Show - Фильмы - Kinfo.ru

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>40) - vestnik.math.msu.su/ )

... The official Tommy Hilfiger logo is made of two navy blue bars that are on top and bottom Читать далее cheap michael , cheap moncler . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>122) - elana.sinp.msu.ru/ )

• military men have cropped their hair close to the scalps. | С Днем Победы!
• cheap ray bans Collo Solutions to Handle Disaster Recovery | С Днем Победы!
• editor | С Днем Победы!

... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>10) - bioinf.fbb.msu.ru/ )

• SDPlight
• Input Formats
• SDPsite - Algorithm Format requirements

and 42 % 27-11-1999 Andr\'as Holl % 2.31: 02-05-2001 % % Konkoly Observatory, Budapest, Hungary % Use the following documentstyle definition : % \documentstyle[twoside, ibvs2, epsf]{article} % or % \documentstyle[twoside]{article} % \input ibvs2.sty % \input epsf.sty % epsf is only needed for figures % IBVS.STY screen message \ typeout {} \ typeout {IBVS.STY Ver. 2.31 - 02-05-2001 } \ typeout {Information Bulletin on Variable Stars - Konkoly Observatory} \ ...

Еще в разделе: (Показать все результаты (>95) - sai.msu.ru/ )

• Презентация PowerPoint

... http://ani.cmc.msu.ru/geol 2010/2011 . ... 2010 9 / 36 C++ -- C++ -- main Main MAIN 1 2 3 4 5 6 7 8 9 # include < iostream > using namespace std ; int m { c s r } ain () out << " Hello , World !" << endl ; ystem (" pause "); eturn 0; . ... 2010 15 / 36 C++ () 1 2 3 4 5 6 7 8 9 # include < iostream > using namespace std ; int m { c s r } ain () out << " Hello , World !" << endl ; ystem (" pause "); // wait for user to press any key eturn 0; 5, 9: 6: cout -- , 6: , , << 6: endl . ...

Еще в разделе: (Показать все результаты (>18) - ani.cmc.msu.ru/ )

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>26) - seac47-2.phys.msu.ru/ )

Proposals and projects in the Coordinated Call FP7-ICT-2011-EU- Russia Information Meeting Moscow: 21st October, 2010 EU- Russia Call Ї First ICT Joint Call with Russia (dedicated INCO Call in WP 11-12); joint calls have already been implemented in other areas of FP7 Ї Russia is investing in High Performance Computing: No 12 supercomputer in the top500 list is Russian; aiming to enter Top3 already in ...

Еще в разделе: (Показать все результаты (>110) - www.msu.ru/ )

• http://www.msu.ru/work/vacansia.pdf
• Faculty of Soil Science
• MSU Staff (2003)

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The laboratory of chemistry and physics of sensor and semiconductor materials is the largest laboratory of Inorganic chemistry department , Lomonosov Moscow State University. The laboratory staff include 21 members and there are 25 students and postgraduate students of Chemistry Faculty , Physics Faculty and Faculty of Materials Science . ... semiconductor materials for sensors . ... Phone: +7(495) 939 54 71 . ...

Еще в разделе: (Показать все результаты (>18) - www.lssm.inorg.chem.msu.ru/ )

... 2.HM Category Ownership: Lead the procurement of a number of HM Raw Material categories. e.g. AntiOxidants, Oils . 3.Strategic procurement - 'C' raw materials: In close cooperation with the Procurement Managers within Europe, define and implement, the 'C' Raw Material procurement strategy. ...

Еще в разделе: (Показать все результаты (>51) - www.chemport.ru/ )

• "Applied r filtration manager, phd, belgium" - вакансия в разделе "Работа для
• "R scientist/expert in catalysis-related chemistry, phd" - вакансия в разделе
• "R scientist/expert in catalysis-related chemistry, phd (m/f)" - вакансия в

From the very beginning of its history, PC GAMESS included fully-functional NBO module . However, NBO part of the PC GAMESS/Firefly requires activation as it is a commercial code. You have to purchase PC GAMESS/Firefly NBO license codes and NBO manual from TCI/NBO . ... license nbolid=lid nbokey=key $end . nbo < nbo options > $end . Normally, you need to receive both NBO activation key (nbokey, 8-digit hexadecimal code), and NBO license ID (nbolid, some decimal number) from TCI. ...

Еще в разделе: (Показать все результаты (>127) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - Potential Energy Surface (PES) scan features
• Firefly DOCUMENTATION - command line arguments
• Just CUDing: Firefly v. 7.1.G standard MP4(SDTQ) benchmark on NVidia GPUs or

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>148) - www.genebee.msu.ru/ )

• GEA :: Gene Expression Analysis
• BLAST Basic Overview

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )

Arthropoda Selecta 19(2): 101-102 © ARTHROPODA SELECTA, 2010 Inermocoelotes Ovtchinnikov, 1999, a valid genus (Aranei: Amaurobiidae: Coelotinae) Inermocoelotes Ovtchinnikov, 1999 валидный род (Aranei: Amaurobiidae: Coelotinae) Kirill G. Mikhailov К.Г. Михайлов Zoological Museum, Moscow State University, Bolshaya Nikitskaya Str. ... ABSTRACT: A new synonymy is established: Eurocoelotes Wang, 2002 = Inermocoelotes Ovtchinnikov, 1999, syn.n. The rank of the latter taxon is elevated tothe genus level. ...

Еще в разделе: (Показать все результаты (>1353) - zmmu.msu.ru/ )

• http://zmmu.msu.ru/menzbir/Almaty2015/2%20Letter%20-%20Almaty%202015%20ENG.doc
• XIV International Ornithological Conference of North Eurasia: Abstracts
• Russian Journal of Theriology

... 4. (lock-in) - , SIN +1,-1 ; , .3. , . ... y(n)=-a1 y(n-1)+b0x(n)+ b1x(n-1) , .3. "" . ... 2 SIN . # include cdef2181.h # include math.h #define MAX_ INT (32767) #define bufset( buf, val, size) \ ( { int _i; for( _i=0; _i size; _i++) buf[ _i] = val; } ) const int amp=10000; const float pi=3.141592654; int n=0, fr_num=0, sig=0, i=0, STOP_FLG = 0; /* 1 - stop count */ int CHAN = 1; /* current channel to output */ int fr[10] = {100,200,300,400,500,600,700,800,900,1000}; ...

Еще в разделе: (Показать все результаты (>2) - lib.sinp.msu.ru/ )

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>47) - mouse.belozersky.msu.ru/ )

• wLake program homepage
• S : rm_systems