... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>37) - hcs.cmc.msu.ru/ )

• Master program "Software for Computer Networks" | Магистерское и послевузовское
• Master program "Open Information Systems" | Магистерское и послевузовское
• Master program "Mathematical and computer methods of image processing" |

... Course "Computer Physics" for 1st and 2nd year students of Physics . ... The audience is 1st and 2nd year students of Physics. ... It consists of a short lecture course, seminars, and a large number of computer labs. ... 1985-1994 : Lectured a specialized course on "Computer Physics"for the 3rd year students of Physics, Department of Physics, and attendees of the continuing education department, International Laser Center of Moscow State University. ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>98) - qilab.phys.msu.ru/ )

. filename : Cross-device link . The file you are trying to make a link to is located on a different physical device. The solution is to create a symbolic link . directory_name is a directory . You are trying to make a link to a directory. Check the pathname for the file. ln: filename : File exists . A file with the same name as the linkname already exists in the destination directory. Use a different name for the linkname.

Еще в разделе: (Показать все результаты (>486) - comet.sai.msu.ru/ )

• Problems copying files
• Problems using the rm command
• Making a directory

Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>23) - www.elch.chem.msu.ru/ )

... Research . ... 1972 – current: Moscow State University . ... In 1989 she took her doctor's degree in linguistics (kandidat filologicheskikh nauk) at Lomonosov Moscow State University for the thesis "Computer data bases of the Selkup language: creation and use in linguistic research (Mashinnyi fond selkupskogo yazyka: sozdaniye i ispol’zovaniye v konkretnykh lingvisticheskikh issledovaniyakh)”. ... Documentation of and research into endangered languages presupposes linguistic fieldwork . ...

Еще в разделе: (Показать все результаты (>68) - lcl.srcc.msu.ru/ )

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>908) - oit.cmc.msu.ru/ )

• Safe Mode
• Database issues
• Persistent Database Connections

... Лекторий по физике . ... Главная / О факультете / Подразделения факультета / Отделения и кафедры / Кафедра компьютерных методов в физике . ... Методы анализа и интерпретации эксперимента . Математические методы анализа и интерпретации эксперимента разрабатывались на кафедре под руководством проф. Пытьева Ю.П. более 25 лет. ... Методы позволяют эффективно учитывать симметрию решаемой задачи анализа и интерпретации, а также трудно формализуемые сведения о моделируемых объектах и явлениях. ...

Еще в разделе: (Показать все результаты (>4056) - phys.msu.ru/ )

Galina K. Vasilyeva , PhD, senior researcher at the Institute of Physical Chemical and Biological Problems in Soil Science, Russian Academy of Sciences (IPBPSS RAS), head of group of soil bioremediation. Tel. (of.) 096) 773-3830. ... Participant of Russian-American exchange programs: 1. ... Nadezhda D. Anan'eva , PhD, Chief of the Laboratory of soil microbiology at the Institute of Physical Chemical and Biological Problems in Soil Science, Russian Academy of Sciences (IPBPSS RAS). ...

Еще в разделе: (Показать все результаты (>156) - www.prof.msu.ru/ )

• Vladimir Iakimets
• Содержание
• Internationalizing Education In Barnaul State Pedagogical University

... Faculties . ... General Information . ... Study and Research . ... The Faculty has 18 departments: Department of General Mathematics , Department of Non-Linear Dynamic Systems and Control Processes, Department of Mathematical Physics, Department of Computational Methods, Department of Research Automation, Department of Operations Research , Department of Optimal Control, Department of System Analysis, Department of Mathematical Statistics, ...

Еще в разделе: (Показать все результаты (>159) - www.msu.ru/ )

• FACULTY OF COMPUTATIONAL MATHEMATICS AND CYBERNETICS
• Research Priorities in Sciences and Humanities at Moscow State University
• The scheme of an arrangement of MSU buildings on Leninskiye Gory

... On the Institute . ... Laboratory-chair of modelling the natural references of time . ... A.P. Levich , "Motivations and problems in the studies of time". in: "Constructions of Time in Natural Science: On the Way to Understanding the Time Phenomenon''. ... A.P. Levich , "Time as variability of natural systems: methods of quantitative description of changes and creation of changes by substantial flows. in: "Constructions of Time in Natural Science: On the Way to Understanding the Time Phenomenon". ...

Еще в разделе: (Показать все результаты (>696) - chronos.msu.ru/ )

• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and
• On the Way to Understanding the Time Phenomenon: the Constructions of Time in
• O.S.Razumovsky. Models of Time in Physics and Cosmology

... Department . ... Courses . ... Course Name . ... Prof. Fedor S. Zaitsev . ... Prof. Alexander M. Popov . Visualization in Scientific Research . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Vladimir V. Nefedov . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Prof. Alexander P. Smirnov . Two-Dimensional Problems of Mathematical Physics . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>22) - ani.cmc.msu.ru/ )

• Courses
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• Department of the Automation for Scientific Research CMC MSU | Computational

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>112) - www.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Faculty of Geology >> Geology at Moscow State University
• Faculty of Geology >> Departments

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>7) - tex.bog.msu.ru/ )

О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>3) - mkma.math.msu.su/ )

Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...

Еще в разделе: (Показать все результаты (>21) - imaging.cs.msu.ru/ )

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>32) - nano.msu.ru/ )

• Registration for the International School ?Computer simulation of advanced
• Schools | MSU Nanotechnology Education and Research Center

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

... DEVISER . loosely-coupled Datalog EValuator Integrated with SchemE . ... Chair of System Programming . ... Documentation . ... DEVISER - is research project in progress, open-source system that can evaluate programs of language of logic programming of databases, Datalog. DEVISER involves the ideas of logic programming, database theory and functional programming. ... Nov 24 2006: DEVISER 1.2.1 is available: deviser-1.2.1.tar.gz . ... May 24 2004: DEVISER 1.2.0 is available: dtlog-1.2.0.tar.gz . ...

Еще в разделе: (Показать все результаты (>236) - sp.cs.msu.ru/ )

• Кузнецов Сергей Дмитриевич
• RAMPA - CASE for portable parallel programs development
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

... PHYSICAL CHEMISTRY DIVISION . ... GENERAL COURSE: NUMERICAL METHODS AND COMPUTER PROGRAMMING (for advanced students in numerical methods in chemistry) . SPECIAL COURSE: MATHEMATICAL MODELS AND COMPUTATIONAL METHODS IN PHYSICAL CHEMISTRY (for post-graduate students) . ... Molecular Structure, Molecular Spectroscopy, Mathematical Models, Numerical Methods. ... A.V. Abramenkov and I.A. Abramenkova. ... S.V. Krasnoshchiokov, A.V. Abramenkov and Yu.N. Panchenko. ...

Еще в разделе: (Показать все результаты (>1140) - chem.msu.ru/ )

• Computers in Moscow (Russia)
• Moscow University Chemistry Bulletin Vol. 42, No. 4, P. 241 (2001)
• PC Crystal Chemistry Analysis of Organic Crystal Structures