A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>125) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... About Journal | ... Sociology and Political Science publishes original works on sociology and political science, results of research and experiments in social and political spheres in Russia and abroad, methodological innovations, information about conferences, reviews of the recent books in sociology and political science. ... Please include full article title both in Russian and English. ... Information about the author/authors both in Russian and English. ... References. ...

Еще в разделе: (Показать все результаты (>62) - www.socio.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>33) - www.msm.biophys.msu.ru/ )

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>17) - foroff.phys.msu.ru/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>81) - uneex.mithril.cs.msu.su/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>260) - uneex.lorien.cs.msu.su/ )

• Relocatable Wrinkles: Things to Consider
• Conditionals
• Module Index - Apache HTTP Server

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Bulletin of experimental biology and medicine [Bull exp biol med] . Common information . ... no information] . ... since 1980-01-01 till today . ... medicine . ... In russian till 1936. ... Russian Academy Of Medical Sciences (RAMS) . ... http://medi.ru/doc/80.htm . ...

Еще в разделе: (Показать все результаты (>124) - journals.genebee.msu.ru/ )

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>151) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/talks/2009oberwolfach-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2007moscow-nmu-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2013tianjin-talk.pdf

Lomonosov Moscow State University was established in 1755 . ... Faculties . ... The Faculty offers Specialist Degree programs (6 years) and Master?s Degree programs (2 years). Students at the Moscow State University Faculty of Psychology are obliged to study two foreign languages: English, for five years, plus two years? study of the second foreign language (chosen by the student. ... The duration of Master?s Degree programs is 2 years (daytime study), or 2.5 years (evening study). ...

Еще в разделе: (Показать все результаты (>63) - www.msu.ru/ )

• Lomonosov Moscow State University Institute of Russian Language and Culture
• Bachelor studies
• Master studies

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>156) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>257) - www.philol.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>6) - www.issp.ac.ru/ )

.

55. http://temporology.bio.msu.ru/discussions/kuznetsov_vremya.pdf

56. Leading scientific fellow Sergey Piskarev Ph.D.

57. Lib-DVM. Interface description

58. Поясняющие фразы

59. http://theorphys.phys.msu.ru/education/aqft_slides/Handout_Term2.pdf

60. Systema Naturae