... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>127) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs
• About me
• NATO Scientific & Environmental Affairs

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>11) - hcs.cmc.msu.ru/ )

... About Journal | ... Sociology and Political Science publishes original works on sociology and political science, results of research and experiments in social and political spheres in Russia and abroad, methodological innovations, information about conferences, reviews of the recent books in sociology and political science. ... Please include full article title both in Russian and English. ... Information about the author/authors both in Russian and English. ... References. ...

Еще в разделе: (Показать все результаты (>66) - www.socio.msu.ru/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>70) - uneex.mithril.cs.msu.su/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>248) - uneex.lorien.cs.msu.su/ )

• Relocatable Wrinkles: Things to Consider
• Conditionals
• Real-World Package Building

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>42) - www.msm.biophys.msu.ru/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>8) - theorphys.phys.msu.ru/ )

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

... Bulletin of experimental biology and medicine [Bull exp biol med] . Common information . ... no information] . ... since 1980-01-01 till today . ... medicine . ... In russian till 1936. ... Russian Academy Of Medical Sciences (RAMS) . ... http://medi.ru/doc/80.htm . ...

Еще в разделе: (Показать все результаты (>121) - journals.genebee.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>137) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>8) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>259) - www.philol.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>190) - mccmb.belozersky.msu.ru/ )

.

56. http://higeom.math.msu.su/people/taras/TTC/slides/arzhantsev.pdf

57. Other prospects of the change-point based analysis

58. http://temporology.bio.msu.ru/discussions/kuznetsov_vremya.pdf

59. http://www.prof.msu.ru/eng/info/Application%20instructions.doc

60. Leading scientific fellow Sergey Piskarev Ph.D.