... Institute Laboratory-Chairs . ... Laboratory-chair of causal mechanics . ... Two experimental setups for study of Kozyrev's transaction of the dissipative processes had been created. ... Existence of Kozyrev's transaction of the geophysical dissipative processes of various nature: synoptical, geoelectromagnetic, ionospheric ones and also the solar activity has experimentally been shown. ... Existence of retarded, zero and symmetrically advanced time lay in nonlocal transaction has been confirmed. ...
... Home Resources Publications Agricultural markets and global state of food.. ... Since the beginning of the 2000s the situation in the global agro-food market is characterized by the upward trend against the background of price volatility. The increase in consumption in developing countries, especially China and India, along with rising incomes and a shift in demand for more nutritious foods are some of the factors that determine the long-term increase in demand for agricultural commodities. ...
News of PARALLEL.RU par-news на mail.parallel.ru . Вт Май 7 17:48:13 MSK 2013 . Следующее сообщение: PARALLEL.RU - Новости, выпуск #346 [21/05/2013] . ... Выпуск 345. 7 мая 2013 г. ------------- Московский государственный университет имени М.В.Ломоносова, Суперкомпьютерный консорциум университетов России, факультет ВМК МГУ, НИВЦ МГУ объявляют о проведении с 24 июня по 6 июля 2013 года международной Летней Суперкомпьютерной Академии. ... Подробная информация о списке рассылки par-news . ...
... О физическом факультете . ... Новости . ... Помощь факультету . ССО факультета . ... Система электронного документооборота (СЭД) МГУ . Удаленный доступ к информационным ресурсам физфака . ... Физический факультет . ... Наш факультет . Новости факультета . ... Символика физфака . ... Журнал "Ученые записки физич. факультета МГУ" . Онлайн доступ к научным журналам и книгам . ... Научные семинары . ... Журнал "Ученые записки физического факультета МГУ" . ... New Trends in Aeroacoustics: . ...
... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...
VIII International Workshop on Advanced Computing and Analysis Techniques in Physics Research (24-28 June, 2002; Moscow, Russia) 1. REGISTRATION INFORMATION |Family name |First name ____________________ Sex | ... Phone (icl. codes) |Fax | ... Passport |Date of |Date of | ... HOTEL ACCOMMODATION Please select the hotel and type of room you prefer to book: | ... Price per |Mark for| ... BANK TRANSFER "ACADEMSERVICE DMC", account of Commercial Bank "LOKO-BANK" ( Moscow, Russia, Kosmodamianskaya emb., ...
University Satellites and . Space Science Education . ... Use of microsatellite technology in aerospace education by the example of BAUMANETS microsatellite project . ... Launch is scheduled for March 2006. ... Over 20 students graduated from BMSTU and found work in leading Russia s and international aerospace companies. ... Meanwhile, modern labor market in aerospace shows increasing requirements towards quality of university education. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Laboratory of Liquid Crystals . ... LCOptimizer is a realization of algorithm for calculation of nematic and cholesteric LC structure in PDLC droplets. ... Current version of LCOptimizer software consists of the following units: . ... lcdis3 -- quick change of external field, surface tension or director field distribution in already prepared input file . ... User Manual . User Manual contains general information about the program, input and output description, and some additional tips. ...
... 13, Moscow 119992, Russian Federation, e-mail: busarev@sai.msu.ru; 2 Research Institute Crimean Astrophysical Observatory, p/o Nauchnyi, Crimea 334413, Ukraine, e-mail: prok@crao.crimea.ua Summary: We propose a combined method of astronomical investigations of small or distant planets incorporating registration of a set of integral spectra of an object and their frequency analysis. ... An application of the method is shown on example of asteroid 21 Lutetia. ... 6] Busarev V. V. (2002), Solar Sys. ...
[
Текст
]
Ссылки http://selena.sai.msu.ru/Bus/Publications/m44_14_busarev_etal.pdf -- 93.8 Кб -- 17.02.2009 Похожие документы
... Head of the department: Yury Osipov, Academician of RAS, Professor, Dr.Sc. ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 724, 725, 728, 745, 748 (Head of the department) . Optimal control is a field in mathematics that develops tools for formalizing and methods for solving problems of choosing the best (in a preliminary prescribed sense) strategy to control a dynamic process. ... Prof. Khailov, 32 lecture hours and 32 seminar hours, 5th semester. ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
The emergence of life based on amino acid and RNA/ DNA on an Earth type planet requiers a quite narrow parameter space of many of the planet's physical parameters, most important are its mass and temperature conditions. ... The period, more or less, is conserved for the giant planets.) ... Thus, the mass of a terrestrial planet suitable for the advent of the LANA should be close to 5*10 27 g. The same value follows from quite a different condition: the planetary atmosphere should be retained. ...
... THEORETICAL PRINCIPLES AND METHODS OF REMEDIATION OF SOILS POLLUTED WITH HEAVY METALS . Galina Koptsik . ... Development of current principles and approaches for soil remediation in heavy metal polluted areas. ... The project aims to study and develop, both theoretically and experimentally, the current approaches to remediation of soils polluted with heavy metals. ... Potentialities and constraints of different approaches for remediation of heavy metal polluted soils will be analysed. ...
... help . find changesets by author, revision, files, or words in the commit message Template Usage Mercurial allows you to customize output of commands through templates. ... Usage: $ hg log -r1 --style changelog A template is a piece of text, with markup to invoke variable expansion: $ hg log -r1 --template "{node}\n" b56ce7b07c52de7d5fd79fb89701ea538af65746 Strings in curly braces are called keywords. ... The changeset bisection status. bookmarks List of strings. ...
... help . find changesets by author, revision, files, or words in the commit message Template Usage Mercurial allows you to customize output of commands through templates. ... Usage: $ hg log -r1 --style changelog A template is a piece of text, with markup to invoke variable expansion: $ hg log -r1 --template "{node}\n" b56ce7b07c52de7d5fd79fb89701ea538af65746 Strings in curly braces are called keywords. ... The changeset bisection status. bookmarks List of strings. ...
... Scientific supervisors: Dr. I.M. Pelivanov, Dr. A.M. Lomonosov Subsurface residual stress testing in metals with laser pulse excited wideband acoustical waves Two laser ultrasonic techniques for non-destructive testing of subsurface residual stress in metals are developed in the current work. ... Another technique is based on laser excitation of surface acoustical Rayleigh waves pulses and intended for in-plane distributed biaxial residual stress testing. ...
[
Текст
]
Ссылки http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Devichensky_Pelivanov_en.pdf -- 9.3 Кб -- 18.12.2006 Похожие документы
... Харитонашвили . ... На рост корней влияют условия минерального питания, в частности, доступность ионов нитрата. В 2000 г. было установлено локальное стимулирующее действие NO 3 - на рост боковых корней Arabidopsis : ответная реакция проявлялась в удлинении боковых корней, находящихся в зоне локального внесения NO 3 - . Высокие концентрации NO 3 - при равномерном распределении в среде приводили к системному ингибированию роста боковых корней и главного корня Arabidopsis (Zhang et al., ...
... Konarev D.V., Kuzmin A.V., Troyanov S.I., Nakano Y., Khasanov S.S., Otsuka A., Yamochi H., Saito G., Lyubovskaya R.N. Anionic coordination complexes of C 60 and C 70 with cyclopentadienyl and pentamethylcyclopentadienyl molybdenum dicarbonyl , Dalton Transactions (2015) 44 , 9672-9681 DOI . Ioffe I.N., Yang S., Wang S., Sidorov L.N., Kemnitz E., Troyanov S.I. C 100 is converted into C 94 Cl 22 via three chlorination-promoted C 2 losses under formation and elimination of cage heptagons , Chem. ...
... The detectors used in the setup had efficiency three orders of magnitude better than ones used before. ... As a result, effect of nonlocal influences of several largescale processes related with the weather changes, the geomagnetic variations, the ionospheric and solar activity have reliable been detected. ... йи з ед гв б 7 (2) (3) (4) All known local factors influencing on : temperature, pressure, chemism, illumination, electric field etc. must be excluded or stabilised. ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf -- 224.4 Кб -- 27.02.2014 Похожие документы