Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>91) - scon155.phys.msu.su/ )

• Polariton spectroscopy as a method of studying the effects of lattice
• Theory of electronic properties of disordered semiconductors and systems with

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>124) - hist.msu.ru/ )

• Dr. Michelle Marrese's Course "Women in the Age of Enlightenment"
• St. Petersburg as International Business Center in the 19th century
• Department of Russian History of the 20th Century

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>110) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

... Publication data for the ACAT'2002 Proceedings are available (you may download also a Word file ). ... Information on publication of the ACAT'2002 Proceedings and instructions on submission of contributions are available on our Web site. ... Everybody is invited to send interesting pictures! ... Materials (slides etc) of poster presentations appear in our Web data base (check "Programme" page). ... SLIDES of tutorials are available (check "Tutorials" page, then go to particular tutorial page). ...

Еще в разделе: (Показать все результаты (>62) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ohl/acat2002.pdf
• http://acat02.sinp.msu.ru/presentations/kotikov/poster.ps
• http://acat02.sinp.msu.ru/presentations/davydychev/acat2002.pdf

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>4455) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

... 113, 144 ­ 167 January 1998 The resonance fluorescence spectrum of a -system excited by two resonant light fields is calculated using a Markov analysis. ... Its spectrum consists of two multiplets which are similar to a triplet in the resonance fluorescence spectrum of a twolevel atom and lie at the electronic transition frequencies, together with two triplets located at the frequencies of four-photon processes involving the optical excitation fields. ... The last two are diagonal elements. ...

Еще в разделе: (Показать все результаты (>70) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/VMU-No.%205,%20pp.%20315-320%20(2008)-EN.pdf
• http://qilab.phys.msu.ru/papers/JETP-1999-89(4)-en.pdf
• http://qilab.phys.msu.ru/papers/OpticsSpectroscopy-1999-87(3)-en.pdf

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>112) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description

... Division of General Nuclear Physics MSU . ... INP MSU . ... Faculty of Physics MSU . ... The ANTARES project is the largest project on registration astrophysical neutrino by detection of cherenkov radiation from secondary particles, arising by neutrino interaction with substance of the Earth. ... Since June, 2009 the group of the Lomonosov Moscow State University takes part in the project. ... Our group consists of young researchers of MSU Skobeltsyn Nuclear Physics Institute and Faculty of Physics....

Еще в разделе: (Показать все результаты (>20) - antares.sinp.msu.ru/ )

• ANTARES в МГУ

The International Society for the Study of Time Fifteenth Triennial Conference Time and Trace June 30 - July 6, 2013 Orthodox Academy of Crete http://www.oac.gr/htm/main_en.html Call for Papers Proposals (300 words) due by June 30th, 2012 The International Society for the Study of Time (ISST) seeks proposals for presentations at its 2013 conference on the island of Crete, on the theme of Time and Trace. ... Works of literature were also called "brush traces" (hisseki) in Japanese. ...

Еще в разделе: (Показать все результаты (>336) - chronos.msu.ru/ )

• A METHOD FOR DETERMINING ECOSYSTEM NORMAL FUNCTIONING REGIONS
• Table 1
• Гуц А.К. Хроногеометрия.

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Mathematical Reviews MR2056325 . What makes this new book an outstanding contribution to stability theory? First of all, the book succeeds in bringing qualitative results of the famous Russian school of applied mathematics to stability theory, making these results quantitative and applicable. ... Reviewed by Professor Wolfhard Kliem . ...

Еще в разделе: (Показать все результаты (>29) - mailybaev.imec.msu.ru/ )

• Multiparameter Stability Theory with Mechanical Applications

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

ON THE ORIGIN OF THE KAIDUN CR2 CHONDRITE GLASSES Kashkarov L.L., Kalinina G.V., Skripnik A.Ya. ... In given work the results of structural, petrology-chemical and track researches of glass fragments of a meteorite Kaidun are presented: On the basis of the received data the possible processes of origin of these glasses at an early stage of formation of a meteorite parent body are considered. ... The glass samples were preferentially out of crushed Kaidun meteorite. ... Nuclear Tracks in Solids. ...

Еще в разделе: (Показать все результаты (>339) - geo.web.ru/ )

• http://geo.web.ru/users/pavel/Publications/2002/theses_correct.doc
• http://geo.web.ru/conf/alkaline/2009/Khomyakov.htm
• http://geo.web.ru/conf/alkaline/2009/Litvin2.htm

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>8) - theorphys.phys.msu.ru/ )

. Jump to: navigation , search . You must log in to view other pages. Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:Contributions/93.180.27.85 " . Special page . Log in . Новости, главное . Страница курса . Сдача заданий . 1-й семестр 2015 г. Материалы по системе ejudge . Планы прошлых лет . Участники . Recent changes . Special pages . Privacy policy . About MediaWiki . Disclaimers

Еще в разделе: (Показать все результаты (>5) - algcourse.cs.msu.su/ )

... Role of Asymptotics in Nonlinear Acoustic Propagation . ... From the mid-1970s until his untimely death in 2000, Professor David Crighton made a significant contribution to the study of nonlinear acoustic propagation using matched asymptotic expansions. ... The derivation of model equations such as the Generalised Burgers Equation will be outlined, using multiple scales methods based on the slow distortion of a disturbance due to nonlinearity and dissipation/dispersion mechanisms. ...

Еще в разделе: (Показать все результаты (>174) - acs366.phys.msu.su/ )

• Abstract
• General Information

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

58. http://nanofluidics.phys.msu.ru/paper/LA026419f2.pdf

59. http://beams.chem.msu.ru/sotrudniki/larin/IJQCh_04.pdf

60. JCatalog >> Journal information >>