... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>72) - uneex.mithril.cs.msu.su/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>231) - uneex.lorien.cs.msu.su/ )

• An In-Depth Discussion of Virtual Host Matching - Apache HTTP Server
• perchild - Apache HTTP Server
• Real-World Package Building

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>2) - bioinf.fbb.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>86) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.doc
• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• Yurii Naumovich Lipsky

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>87) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>52) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

.

50. LangueDOC :: Movie

51. Leading scientific fellow Sergey Piskarev Ph.D.

52. http://geo.web.ru/conf/alkaline/2009/Butvina2.htm

53. Lib-DVM. Interface description

54. http://www.elch.chem.msu.ru/mole/lecture/qnazmutdinov.pdf

55. Global fossil bat records - abstract

56. Abstract

57. http://higeom.math.msu.su/people/taras/TTC/slides/arzhantsev.pdf

58. JCatalog >> Journal information >>

59. An In-Depth Discussion of Virtual Host Matching

60. http://lve.sinp.msu.ru/~rud/Atlas/soft/configuration.log1