... For SUSY this quantum numb er is R-parity, for IDM that is sp ecific D-parity 2 Most probable: Dark matter particle is neutral D0, Mass < 60 - 70 GeV,(to prevent annihilation D0D0 W +W - even slightly b elow threshold) The charged particles having the same quantum numb er DБ are heavier than 100 GeV (LEP), In the scalar case the counterpart with opp osite P-parity DA also exists, they are lighter than ab out 120 GeV(LEP). ... Their cross sections contains additional factor - two orders lower. ...

Еще в разделе: (Показать все результаты (>162) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/nekrasov.pdf

. Coordinates . Charged particles flux . Ultraviolet radiation . The periods of high geomagnetic activity in 2005. 10 MeV, the data from the NOAA series satellites) . January 20-26 . May 5-20 ( data is available ) . June 16-19 . July 13-21 ( data is available ) . July 26 - August 6 . August 22 - September 3 ( data is available ) . September 7-20 ( data is available ) . Charged particles flux measured by Coronas-F satellite

Еще в разделе: (Показать все результаты (>38) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>63) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Head of the Department of Emission-line Stars and Galaxies of SAI MSU . ... Structure and kinematics of galaxies . ... Strasburg Database . Hubble Telescope Archive . ... CFHT Archive . ... Chinese evolutionary synthesis Yunnan . Korean evolutionary synthesis Yonsei . Evolutionary synthesis database BaSTI . ... Electronic Journal "New Astronomy" . Electronic Astrophysical Journal . Electronic Astronomical Journal . ... Questions and comments send to Olga Sil'chenko olga@sai.msu.su ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

... To edit pages on this TWikiSite , you must have a registered user name and password. ... This database is accessible to anyone who can access the server through the web (though passwords will be encrypted, and e-mail addresses will be obfusticated to help prevent spamming). ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ...

Еще в разделе: (Показать все результаты (>28176) - dualopt1.cmm.msu.ru/ )

• TWikiRegistration - TWiki - TWiki - (printable)
• CGISessionDriverDBIDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... Fullerenes. ... 743-748, (1998) . ... C60 water suspension was studied. Particles size distribution in fresh and treated water suspension was measured, proving that particles in treated water suspension are 250 nm in diameter, which is favourable for photopolymerization. Ultra-violet and visual spectra of water suspension were obtained to explore, whether suspension is capable of polymerization. The oxydation of water suspension during photopolymerization was estimated to be insignificant. ...

Еще в разделе: (Показать все результаты (>518) - chem.msu.ru/ )

• Laboratory of Crystal Chemistry, Chemistry Department, Moscow State University
• Moscow University Chemistry Bulletin Vol. 48, No. 3, P. 182 (2007)
• Emulsion Adagulation if Colloidal Particles and Wetting of Gold Surface by

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>43) - old.philol.msu.ru/ )

• HumLang: Polikarpov A.A.- Menzerath's Law for Morphemic Structures of Words:A
• MSU - Laboratory for General and Computational Lexicology and Lexicography

Eleven steps to right understanding of time . ... Motion of objects and particles do not happen in time, it happens in space only. ... As a "fourth" coordinate of space-time time is a "coordinate of motion", it describes motion of massive bodies and particles into space. ... In a model of space-time we describe motion of objects and particles into space. ... Space itself is atemporal. ... Time as a "coordinate of motion" is not elementary physical quantity as energy, matter, space and motion are. ...

Еще в разделе: (Показать все результаты (>407) - chronos.msu.ru/ )

• Laboratory-chair "Time as a phenomenon of the Universe expansion"
• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and
• The biotic conception of aquatic ecosystem control

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>25) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_anon.c

: «SAP HANA ­ the main memory database platform for modern hardware» «SAP HANA ­ » 23 2013 . 18.30 : Franz Faerber, : - SAP SAP HANA (High-Performance Analytics Appliance) ­ , . «in-memory» SAP . , SAP HANA «in-memory» , , . SAP HANA , SAP HANA, SAP Labs . : Franz Faerber, SAP 1994 ., - SAP. SAP HANA, . : . .. , (2- ), . -8 ! 22 : mag-prog@lvk.cs.msu.su http://erp.cmc.msu.ru/ 247, : +7 (495) 939-55-68

52. Master program "Open Information Systems" | Магистерское и послевузовское

53. ASTROMETRY DEPARTMENT of SAI

54. http://selena.sai.msu.ru/Pug/Publications/ms38/ms080.pdf

55. Forest ecosystem data in Norwegian-Russian border area

56. http://www.inpro.msu.ru/files/do/Minyailov.files/outline.htm

57. Generation of superoxide by the mitochondrial Complex I.

58. http://lms.cs.msu.su/

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда