... The purpose of our research was to find significant differences in island and mainland plant populations of the Russian White Sea. ... New islands were inhabited from the mainland, and as a result the population on it becomes isolated from the mainland. ... As a result the island population becomes different from the mainland populations. ... On each plant we measured about 8–12 morphological characteristics, which are known to be the most variable; 59 morphological characteristics in all. ...

Еще в разделе: (Показать все результаты (>236) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis
• Systema Naturae
• ALGAE AND THEIR CHANGES OVER TIME

... Главная Cотрудничество ILC of Bratislava ILCB laboratories Laboratory of Material Analysis Setup for high-resolution luminescence spectroscopy . Optical spectroscopy enables one to characterize substances and measure the parameters of light sources and detectors with high resolution and in a wide spectral range. ... HR 640 monochromator (Jobin-Yvon, USA) . ... Cryogenic setup for optical spectroscopy . ... Analysis of the spectral features of the items used in optical communication systems; . ...

Еще в разделе: (Показать все результаты (>84) - ilc.phys.msu.ru/ )

• Multichannel spectroscopy
• CCD detectors
• Diagnostic appliances and setups for femtosecond spectroscopy

... Fig.1 shows the results of spectra calculations for theoretical ARS diagrams of pole - dipole (1) and dipole equatorial (2) arrays above anisotropic half-space with longitudinal and transversal resistivities equal to 1 and 3. ... The spectrum for AMN array (1) has maximum at zero harmonic (which reflect mean resistivity of the medium), while the second and the next even harmonics are much smaller. ... That is why D array is much more sensitive to anisotropy in comparison with any linear array. ...

Еще в разделе: (Показать все результаты (>56) - geophys.geol.msu.ru/ )

• TES. Processing
• TES. Median algorithm

... Data . ... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. RELEC mission includes x-ray and gamma-ray spectrometer, 3-axis detector for electrons, UV and red-light flash detector, fast optical imager, low-frequency and radio-frequency analyzers of electromagnetic field and waves. ... Electrons 570-850 keV . ... Gamma-rays 50-420 keV + Electrons 0.2-3.15 MeV . ...

Еще в разделе: (Показать все результаты (>39) - smdc.sinp.msu.ru/ )

• Paraboloid model of the Earth's magnetosphere - Space monitoring data center
• IGRF10 model - Space monitoring data center

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>25) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc
• Start-Up Company Development :: Управление инновационной политики и организации

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>292) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• Module Index - Apache HTTP Server
• Compiling Apache for Microsoft Windows - Apache HTTP Server

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>5466) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>22) - curl.sai.msu.ru/ )

... Based on the concept of -matrix and Choi­Jamiolkowski states we develop the approach of quantum process reconstruction. ... The approach is tested with the statistical reconstruction of the polarization transformations in anisotropic and dispersive media realized by means of quartz plates and taking into account the spectral structure of input polarization states. ... Knowing the input and measured (output) states, one can reconstruct the -matrix of the quantum process. ... Mixed state...

Еще в разделе: (Показать все результаты (>92) - qi.phys.msu.ru/ )

• PUBLIC

Configuration Files | ... Options | ... This version of Apache includes changes allowing it to run on IBM's EBCDIC-based TPF (Transaction Processing Facility) operating system. ... It is passed to Apache through the ZINET XPARM field since ZINET is the only way to start the server on TPF. A third group of options apply to both the informational displays (ZFILE) and running the server (ZINET XPARM): -d, -D and -f. The rest of Apache's options are either not applicable or are not supported on TPF. ...

Еще в разделе: (Показать все результаты (>71) - neptun.sai.msu.ru/ )

• Apache module mod_isapi
• Apache modules
• Definitions of terms used to describe Apache modules

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Site-directed mutagenesis of cytochrome c: reactions with respiratory chain components and superoxide radical. ... Three forms of horse heart cytochrome c with specific substitutions of heme cleft surface located amino acid residues involved in specific interactions with ubiquinol:cytochrome c reductase (complex III) and cytochrome c oxidase (complex IV) were constructed, and their reactions with superoxide radical produced by NADH:ubiquinone reductase (complex I) were studied. ...

Еще в разделе: (Показать все результаты (>63) - biochem.bio.msu.ru/ )

• Reversibility of nucleoside diphosphate kinase solubilization from the surface
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

Journal of Alloys and Compounds 444­445 (2007) 518­521 Reduction of actinides in higher oxidation states by hydroquinone-enriched humic derivatives N.S. Shcherbina a a, , St.N. Kalmykov b , I.V. Perminova b , A.N. Kovalenko b Vernadsky Institute of Geochemistry and Analytical ... July 2006; received in revised form 11 January 2007; accepted 12 January 2007 Available online 18 January 2007 Abstract Natural humic materials are known to cause a ...

Еще в разделе: (Показать все результаты (>121) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss-14/docs/IHSS-14-draft-conclusions-Sep-18.pdf
• http://www.mgumus.chem.msu.ru/hit-2010/docs/abstract_template%5BHIT-2010%5D.doc
• http://www.mgumus.chem.msu.ru/hit-2012/docs/abstract_template%5Bhit-2012%5D.doc

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

RAPID COMMUNICATIONS PHYSICAL REVIEW A 77, 011401 R 2008 Laser-assisted control of molecular orientation at high temperatures Dmitry V. Zhdanov* and Victor N. Zadkov International Laser Center and Faculty of Physics, M. V. Lomonosov Moscow State University, Moscow 119992, Russia Received 11 October 2007; published 18 January 2008 A method of laser-assisted field-free dynamic molecular orientation employing a short, moderately intense three-color phase-locked laser pulse is proposed. ... Phys. Scr. ...

Еще в разделе: (Показать все результаты (>74) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/JCTE-2002-en.pdf
• http://qilab.phys.msu.ru/papers/JETP-2003-96(4)-en.pdf
• http://qilab.phys.msu.ru/papers/jetp-96(4)-2003-preprint-en.pdf

... 3 ­ Sternberg State Astronomical Institute, Moscow, :jeanna@sai.msu.ru The graphic method of the analysis of an arrangement of linear structural elements on geographical and geological maps of continents (A.V.Dolitsky, [1]) has allowed to find out global stress fields of the past and among them one which directions (the main normal and maximal tangents) describe more than 80 % of all linear elements of a relief. ... The found poles share program way on density of an arrangement on 3-4 groups. ...

Еще в разделе: (Показать все результаты (>96) - selena.sai.msu.ru/ )

• Yurii Naumovich Lipsky

... The Early Pale oproterozoic gabbronorite dikes contain a secondary component of NRM that is pointed NNW with a strong positive slope that is correlated with the post orogenic collapse of 1.95­1.88 Ga B.P. Formation of the second alternating magnetization phase of rocks is estimated at 1.8­1.75 Ga B.P., which corresponds to the influence of post orogenic hydrothermal fluids. ... Negative folding and contact tests indicate the secondary nature of this high temperature magnetiza tion component. ...

Еще в разделе: (Показать все результаты (>20) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_2_eng.pdf

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>33) - erg.biophys.msu.ru/ )

... By the early 1990s, the distances between IC components became incredibly small, and the relative effect of the interconnect delay became a greater portion of the overall signal propagation delay. ... Replacement of traditional Al by low resistivity Cu decreases RC delay. ... Different types of low-k materials have been considered. Relatively fast developed organosilicate (OSG) based low-k materials met significant challenges during their integration because of their porous structure. ...

Еще в разделе: (Показать все результаты (>182) - polly.phys.msu.ru/ )

• Scientific
• NATO Scientific & Environmental Affairs
• Science

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...