... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>4570) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• allpy: 1fb830d7517e Makefile
• allpy: 30225705261a

Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft N.G. Chechenin Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_ Debris _TAGGED.pdf January 19, 2015 China-Russia Joint Space Science Project Proposals Workshop 2 Space ... Crater formation January 19, 2015 Craters on metal surface from meteoroid particle. ...

Еще в разделе: (Показать все результаты (>133) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Seminars_Pdf-filesPresentations/Chechenin_Presentation_14-01-16.pdf
• http://danp.sinp.msu.ru/LAS/Nimb235_05_448Teplova.pdf
• http://danp.sinp.msu.ru/ACS_pdf/atcol_2.pdf

THE PHOTOMETRIC RESEARCHS OF THE MERCURY'S SURFACE BY MEANS OF DIGITAL MODELS. ... The surface brightness of Mercury was measured Danjon (1933, 1949, 1953) and Harris (1961) in phase angle 3o-123o. The analysis of the various data of the integral photometric gives the results of determination of the main photometric constants for Mercury. ... THE PHOTOMETRIC RESEARCHS OF THE MERCURY'S SURFACE: S.G. Pugacheva The surface brightness of the Mercurian images was established on the geologic map Mercury. ...

Еще в разделе: (Показать все результаты (>110) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Pug/Publications/ms38/ms080.pdf
• http://selena.sai.msu.ru/Symposium/ir_luna_e.pdf
• http://selena.sai.msu.ru/Laz/Publications/6_Automatic%20creation%20of%20the%20hypsometric%20map%20of%20Venus.pdf

... A UNIX system has a lot of daemons. a database is the name given to the combination of a program that can manipulate data, together with the data that it acts upon. a record is a set of data about a person or item. Name, telephone number and postcode is an example of such a set. a field is one part of that record; the postcode for example. a delimiter character separates each field from the field preceding it and the field that follows it. ...

Еще в разделе: (Показать все результаты (>53) - comet.sai.msu.ru/ )

• Digitized Sky Engines
• Index of manual pages: A
• Index of manual pages: J

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

Еще в разделе: (Показать все результаты (>6) - adept.srcc.msu.ru/ )

... Institute Laboratory-Chairs . ... On the other hand, there is an input of a concept of reference system relative motion as invariance breakdown in the intervals of particles motion. ... In pseudo-Euclidean spaces, there is a proved existence of two fundamental types of motion – exterminable, which can be exterminated via matching a reference system, and non-exterminable, which cannot be exterminated via matching a reference system, and which also lays the base for the phenomenon of the course of...

Еще в разделе: (Показать все результаты (>440) - chronos.msu.ru/ )

• Laboratory-chair "Time as a phenomenon of the Universe expansion"
• Eleven steps to right understanding of time
• P.V.Poluyan. Numbers in Space

Humic Substances as Stabilizing Agents for Superparamagnetic Nanoparticles Anastasia Chekanova1, Tatiana Sorkina2, Alexander Dubov1, Evgeny Goodilin1, Natalia Kulikova3, Irina Perminova 1 2 2 Department of Material Science, Lomonosov Moscow State University 119992 , Moscow , Russia Department of Chemistry, Lomonosov Moscow State University, 119992 Moscow , Russia, Department of Soil Science, Lomonosov Moscow State University, ... Sodium chloride was used to encapsulate nanoparticles. ...

Еще в разделе: (Показать все результаты (>112) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2013/2013-polyakov-etal.pdf

Experimental Collaborations . Leading particles" -- E852 -- CMS -- "The Hall D Project" . Scintillation Magnetic Spectrometer MSU": experimental setup . ... fixed target experiment to trace the evolution of transient non-equilibrium hadronic states, as they penetrate through the nuclear matter . an experiment in the polarized proton beam to investigate spin phenomena in the proton-nucleus interactions . ... Participants from Hadronic Interactions Laboratory: . ...

Еще в разделе: (Показать все результаты (>72) - lav01.sinp.msu.ru/ )

• Home Page of L. Sarycheva
• Home Page of I. Lokhtin
• Home Page of A. Demianov

... To edit pages on this TWikiSite , you must have a registered user name and password. ... This database is accessible to anyone who can access the server through the web (though passwords will be encrypted, and e-mail addresses will be obfusticated to help prevent spamming). ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ...

Еще в разделе: (Показать все результаты (>28185) - dualopt1.cmm.msu.ru/ )

• TWikiRegistration - TWiki - TWiki - (printable)
• CGISessionDriverDBIDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>47) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>10) - bioinf.fbb.msu.ru/ )

• SDPsite - Gallery of examples
• Algorithm

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>28) - analyt.chem.msu.ru/ )

• Ссылки для изучения студентам, предполагающим делать курсовую работу в группе

... 7 (495) 939-16-82 info@physics.msu.ru . ... Japan), and Univ. of Oulu (Finland) demonstrated that a power-law size distribution with large-size cutoff, as observed in Saturn's rings, is universal for systems where a balance between aggregation and disruptive collisions is steadily sustained. ... We show that a power-law size distribution with large-size cutoff, as observed in Saturn's rings, is universal for systems where a balance between aggregation and disruptive collisions is steadily sustained....

Еще в разделе: (Показать все результаты (>212) - phys.msu.ru/ )

• XV Lomonosov Conference on Elementary Particle Physics
• XIth Lomonosov Conference on Elementary Particle Physics

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>32) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_anon.c

: «SAP HANA ­ the main memory database platform for modern hardware» «SAP HANA ­ » 23 2013 . 18.30 : Franz Faerber, : - SAP SAP HANA (High-Performance Analytics Appliance) ­ , . «in-memory» SAP . , SAP HANA «in-memory» , , . SAP HANA , SAP HANA, SAP Labs . : Franz Faerber, SAP 1994 ., - SAP. SAP HANA, . : . .. , (2- ), . -8 ! 22 : mag-prog@lvk.cs.msu.su http://erp.cmc.msu.ru/ 247, : +7 (495) 939-55-68

57. http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf

58. ASTROMETRY DEPARTMENT of SAI

59. http://site2010.sai.msu.ru/static/doc/RShomali_site2010.pdf

60. Master program "Open Information Systems" | Магистерское и послевузовское