... Data . ... Models . ... Paraboloid model . ... Dynamic paraboloid model (A2000) allows to calculate the variations of magnetic field of each magnetospheric large scale current systems by empirical data during quite and disturbed periods. ... The IMF penetrated into the magnetosphere as well as field-aligned currents magnetic field are included in the total magnetospheric magnetic field. ... bb(2,i) - ring current magnetic field; . ... BD is the geomagnetic dipole magnetic field at the Earth's...

Еще в разделе: (Показать все результаты (>37) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• APEV service - Space monitoring data center
• COSRAD model - Space monitoring data center

... Straightforward implementation of the summation of the PT series is very inefficient on modern computer architectures because: At least one (or more) slow and typically not pipelined divide operation is required to calculate each individual term of the PT series Summation runs over large amount of data involving some combinations of transformed two-electron integrals, so that it is typically not processor cache-friendly Our goals Address both these problems: 1. ...

Еще в разделе: (Показать все результаты (>89) - classic.chem.msu.su/ )

• Firefly/PC GAMESS DOCUMENTATION - LARGE SCALE MCQDPT2 and XMCQDPT2

Next: Items that Define Paths Up: The sendmail.cf File Previous: An Example sendmail.m4 File . A few or the items in the sendmail.m4 file are required all the time; others can be ignored if you can get away with defaults. The following sections describe each of the items in the example sendmail.m4 file in more detail. Items that Define Paths . Defining the Local Mailer . ... Domain Name Service Related Items . Defining Names the Local System is Known by . UUCP-Related Items . ...

Еще в разделе: (Показать все результаты (>235) - itpm.msu.su/ )

• All About ifconfig
• How to Tell UUCP about other Systems-- the sys File
• Defining Names the Local System is Known by

... Sergey V. Borisov . ... Kaplan A.Ya ., Borisov S.V. , Zheligovsky V.A. Classification of EEG's of adolescents based on spectral and segment parameters for the purposes of schizophrenia diagnostics // Biological Psychiatry, 2005 (ISSN 0006-3223), submitted . Borisov S.V. , Kaplan A.Ya ., Gorbachevskaya N.L., Kozlova I.A. Structural organization of the EEG alpha activity in adolescents with schizophrenic spectrum disorders // Zh . ... Borisov S.V. , Gorbachevskaya N.L., Kaplan A.Ya . ...

Еще в разделе: (Показать все результаты (>67) - brain.bio.msu.ru/ )

• Conclusion
• Parametric segmentation of the EEG
• Change-points in EEG components with different pattern

... О UNИX . ... ExportDump . ... Example with --page parameter using regular expression . Output . ... Known limitations "moin export dump" is an HTML export utility to create static HTML dumps of wiki content. ... The --page parameter is optional and will dump pages matching the pagename. ... With the parameter, the output is limited by ACL rules to pages that can be read by the username. ... Note the --page , --target-dir , and --username parameters must follow the export dump parameters. ...

Еще в разделе: (Показать все результаты (>254) - uneex.lorien.cs.msu.su/ )

• SyncJobTemplate - UNИX

... О UNИX . ... ExportDump . ... Example with --page parameter using regular expression . Output . ... Known limitations "moin export dump" is an HTML export utility to create static HTML dumps of wiki content. ... The --page parameter is optional and will dump pages matching the pagename. ... With the parameter, the output is limited by ACL rules to pages that can be read by the username. ... Note the --page , --target-dir , and --username parameters must follow the export dump parameters. ...

Еще в разделе: (Показать все результаты (>96) - uneex.mithril.cs.msu.su/ )

• SyncJobTemplate - UNИX

... Modern data allow to believe that geodynamic state of specific territory is not a constant but an active factor of landscape dynamics and its components, connected with components by positive and negative feedback. The way to develop this research is through relief structure analysis. ... That is why we, staying within frames of classic landscape science, can assess the role of harmonics in spatial hierarchical organization of landscape. ... Four hierarchical levels of East European plain. ...

Еще в разделе: (Показать все результаты (>3375) - www.sevin.ru/ )

• Laboratories: Laboratory for Microevolution and Domestication of Mammals: Goals
• Povolzhskiy Journal of Ecology: Povolzhskiy Journal of Ecology: 2010, Issue 1
• Povolzhskiy Journal of Ecology: Povolzhskiy Journal of Ecology: 2009, Issue 3

You are here: Foswiki > System Web > Macros > VarURLPARAM (19 Sep 2010, ProjectContributor ) E dit A ttach . Returns the value of the named parameter in the URL or HTTP POST request. ... Control how special characters are encoded . ... See ENCODE for more details. safe : Encode characters '"<>% into HTML entities. url : Encode special characters for URL parameter use, like a double quote into %22 . ... If you have %URLPARAM{ in the value of a URL parameter, it will be modified to %<nop>URLPARAM{ . ...

Еще в разделе: (Показать все результаты (>4873) - wiki.cmc.msu.ru/ )

... Experimental and theoretical study of structure and evolution of hadrons under extreme conditions at high energies . ... Physics of the solar wind, interplanetary magnetic field and solar-terrestrial relations . ... Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . ... Research of fractal structure of aluminosilicates gels by a method of small angle scattering of neutrons and synchrotrons radiations . ...

Еще в разделе: (Показать все результаты (>35) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)

DESY, FLASH and XFEL XFEL XFEL versus FLASH XFEL versus LCLS and SPring8 Two-colour short- pulse photoionization of atoms Infrared (IR) laser pulse : = 1.66 eV ( 800 nm), TL = 2.5 fs I = 10 12 ­ 10 14 W/cm 2 XUV pulse = 70 ­ 130 eV The main parameters: L - duration of the IR pulse XUV - duration of the XUV pulse TL - period of the IR ...

Еще в разделе: (Показать все результаты (>235) - nuclphys.sinp.msu.ru/ )

• The European X- Ray Free-Electron Laser

Haiqing Xu, Yu Gao, Hongqi Zhang, Takashi Sakurai, Masaoki Hagino, D. Sokoloff, A.Pevtsov, Magnetic helicity of solar active regions as revealed by vector magnetograms and coronal X-ray images, Publ. Astron. ... Japan, 64, 54, 12 pages, 2012. We have used photospheric vector magnetograms of 15 different solar active regions to calculate the current helicity parameter, ?av, and the linear force-free field (LFFF) parameter, ?best, that fits best the observed transverse field. ...

Еще в разделе: (Показать все результаты (>157) - srcc.msu.ru/ )

• Arshakian T. G., Stepanov R., Beck R., Krause M., Sokoloff D. Simulations of
• Moss, D., Sokoloff, D., Lanza, A. F..Polar branches of stellar activity waves:
• Lebedeva O. S. Tensor conjugate-gradient-type method for Rayleigh quotient

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>81) - biochem.bio.msu.ru/ )

Backlinks to FormatTokens in all Webs ( Search System Web only ) . ... NEW - 14 Mar 2011 - 23:35 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... NEW - 10 Apr 2011 - 22:07 by ProjectContributor . ... The default output format of a %SEARCH{...}% is a table consisting of topic names and topic summaries. ... NEW - 27 Feb 2011 - 20:56 by ProjectContributor . ... Syntax In the example above .. ...

Еще в разделе: (Показать все результаты (>1886) - wiki.cs.msu.ru/ )

• (backlinks in System Web) FormatTokens < System < Foswiki
• (backlinks in System Web) VarSEARCH < System < Foswiki
• (backlinks in all Webs) VarSEARCH < System < Foswiki

... Parameters . ... Natural Satellites Data Center. Parameters and constants . ... Satellites of Mars . Satellites of Jupiter . Satellites of Saturn . Satellites of Uranus . Satellites of Neptune . Satellite of Pluton . Masses of satellites . Dimensions of satellites . Photometric parameters of satellites . Rotational parameters and poles . Orbital parameters of the outer satellites of Jupiter, Saturn, Uranus and Neptune . ...

Еще в разделе: (Показать все результаты (>14) - www.sai.msu.ru/ )

... 3 Basic «metaphisics» Systemic nature of morphological disparity (BD) BD structure is interrelation among BD forms Structural approach to BD investigation implies analysis of interrelations among BD forms Systemic nature of BD presumes that interrelations among BD forms are in part causal At least some of BD forms could constitute a part of causulities affecting certain properties of some other BD forms 4 Basic «metaphisics» ...

Еще в разделе: (Показать все результаты (>1110) - zmmu.msu.ru/ )

• The spermatozoa structure peculiarities of the subgenus Sumeriomys (Rodentia,

... solvation nucleation of the polymorphs Solute-solute interactions, association parameters , thermodynamics parameters , conformations growth of the crystal Nature of solvent, intermolecular interactions (solute ­ solvent, solute-solute), conformations Lattice energy , entropy of the crystal, symmetry of the lattice, conformations The conformational manifolds is the candidate to be a coordinate of reaction Methods of investigations Quantum chemistry ...

Еще в разделе: (Показать все результаты (>21) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/basilevsky.pdf
• http://www.elch.chem.msu.ru/mole/lecture/probst.pdf

... Географии мирового хозяйства . ... Выберите кафедру . ... Учебно-методический отдел . ... НИЛ возобновляемых источников энергии . ... Global and regional changes of the natural environment . ... The article deals with the factors governing the transformation of environmental and economic image of the towns of Russia during the period of economic growth. ... Geographical cartography . ... Economic assessment of the natural potential of landscapes for resource-oriented geographical investigations . ...

Еще в разделе: (Показать все результаты (>395) - www.geogr.msu.ru/ )

• CONTENTS ? 6 - 2012
• Сергей Сергеевич Зилитинкевич
• CONTENTS ? 2 - 2014

... To define in detail the molecular mechanism of NAD+-dependent formate dehydrogenase, the pH dependences of various kinetic and spectroscopic parameters have been studied: Vmax, Km (NAD+), Km (formate), inhibition constants for structural analogues of substrate (NO3-) and product (CNS-, CNO-, N3-), CD and fluorescence properties. The value of Vmax, rate-limiting hydride transfer, is nearly constant throughout the entire pH range of enzyme stability (6.0-11.2) but decreases below 6. ...

Еще в разделе: (Показать все результаты (>136) - www.enzyme.chem.msu.ru/ )

... April 2013 The application/sql Media Type Abstract This document registers the application/sql media type to be used for the Structured Query Language (SQL). ... Conventions Used in This Media Type Registration IANA Considerations . ... Document . ... Therefore, this document application/sql media type to be used 2. ... IANA Considerations IANA has registered "application/sql" in the standards tree of the "Application Media Types" registry, using the application provided in Section 3 of this...

Еще в разделе: (Показать все результаты (>15518) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc6922.txt
• Index of /pub/gentoo-portage/dev-perl/MooseX-Role-Parameterized/
• wdiff rfc7826-mediatypereg-iana.txt rfc7826-mediatypereg-doc.txt

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search