... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>12) - hcs.cmc.msu.ru/ )

The International Max Planck Research School for Molecular and Cellular Life Sciences, jointly conducted by Munich based Max Planck Institutes and Universities, is an internationally recognized center of scientific and educational excellence. ... While students specialize in a particular research topic, the interdisciplinary context of the program facilitates interactions with researchers from other disciplines and fosters cross-frontier thinking. ...

Еще в разделе: (Показать все результаты (>81) - polly.phys.msu.ru/ )

• Science

Institute of Theoretical Geophysics . ... Consortium for Electromagnetic Modeling and Inversion (University of Utah) . SJ Geophysics Ltd . INFOMINE / Geomine - Geological Exploration and Technology (Links collection) . ... Zonge Engineering: Geophysical Modeling . CEMI software developed at the Center for Electromagnetic Modeling and Inversion (University of Utah). ... AGI Res3Dinv - 3D Resistivity Inversion Software . RINVERT - Resistivity Models and Modeling (or Modelling) Software . ...

Еще в разделе: (Показать все результаты (>28) - geophys.geol.msu.ru/ )

... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>35) - hpc.msu.ru/ )

• MSU SUPERCOMPUTERS: "CHEBYSHEV" | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

... In 1997, the work of Jens Skou devoted to discovery and the study of Na,K-ATPase was culminated in the Nobel Prize. ... Our group works in the collaboration with the University of Montrel, Canada (professor S.N. Orlov), and with the Engelgardt Institute of Molecular Biology, Moscow, Russia (Laboratory of conformational stability of proteins and physical methods of analysis, under the guidance of academician A.A. Makarov). ... S-glutathionylation of the Na,K-ATPase catalytic ? ... Biochemistry (Mosc)...

Еще в разделе: (Показать все результаты (>30) - biochem.bio.msu.ru/ )

• Gating mechanisms of a natural anion channelrhodopsin.
• Reversibility of nucleoside diphosphate kinase solubilization from the surface
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>19) - physcontrol.phys.msu.ru/ )

• Icons

.

49. Laser Graduate School

50. http://lve.sinp.msu.ru/~rud/Atlas/soft/configuration.log1

51. Noise Meter

52. About this site | CMC MSU

53. CV of Alexander Moskovsky

54. http://qsar.chem.msu.ru/~dmitry_o/gskdata.html