Supernovae 2011ae in MCG -3-30-19 . This page is devoted to information on Supernova 2011ae in MCG -3-30-19 . Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . ... Discovered by Catalina Real-Time Transient Survey and Stan Howerton as part of their Supernova Hunt . ... This supernova is in the Constellation Crater . ... 2011/02/12.43 . ... Joseph Brimacombe . ... JM Llapasset . ... Back to Bright Supernovae - 2011 . ...

Еще в разделе: (Показать все результаты (>441) - www.rochesterastronomy.org/ )

• Supernova 2002an in NGC 2575
• Supernova 2002dp in NGC 7678
• Supernova 2001gd in NGC 5033

... I. The Essence of Systemology and its Concepts . 1.1 Primary Concepts of Systemology (The Logic of Systems) . ... 1.5 The Essence of the System, and the Foundations of its development and Determinants . The foundation, the essence, and the essential and "essence" properties of the system. ... Adaptivity and Reflection . ... Advanced Reflection. ... The Communicative Situation and the Communicative Act. ... Meaning, sense, the linguistic sign, the speech sign, the moneme, and natural language. ...

Еще в разделе: (Показать все результаты (>54) - old.philol.msu.ru/ )

... Другие названия журнала: Advances in Space Research (includes Cospar Information Bulletin , Advances in Space Research(includes Cospar Information Bulletin) . ... Lipunov V. в журнале Advances in Space Research (includes Cospar Information Bulletin) . ... Sajid M. , Chechenin N.G. , Torres F.S. , Khan E.U. , Agha S. в журнале Advances in Space Research (includes Cospar Information Bulletin) , том 56, с. 314-324 DOI . ...

Еще в разделе: (Показать все результаты (>954) - istina.msu.ru/ )

• Journal of Object Technology - журнал | ИСТИНА - Интеллектуальная Система
• Virchows Archiv. B, Cell pathology including molecular pathology - журнал |
• Gafarov E.R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>21) - www.eng.math.msu.su/ )

... Main field of scientific activities: photometric investigations of various stars, close binary stellar systems and other astronomical objects, including research with use of fast photoelectric photometry with a high time resolution till 1 millisecond. ... New portable photometer . ... The system photometer + PC will ensure recording of the light flux from objects under study with a high time resolution down to 1 ms. To see a components of this New photometer as they looked recently, click on. ...

Еще в разделе: (Показать все результаты (>361) - lnfm1.sai.msu.ru/ )

• Speckle polarimeter
• Manpage of FITSHDR
• Proposing a METI Institute

... Master Education . ... Master programs . ... Master program "Mathematical Models of Complex Systems: Theory, Algorithms, Applications" . ... The Mathematical Models of Complex Systems: Theory, Algorithms and Applications Master?s programme is aimed at studying the foundations of computational methods and software for new types of current problems in modelling, decision-making, and control of complex systems. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>28) - hcs.cmc.msu.ru/ )

• Master program "Software for Computer Networks" | Магистерское и послевузовское
• Master program "Information Security and Cryptography" | Магистерское и
• Mathematical Models of Complex Systems: Theory, Algorithms, Applications |

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>196) - www.geogr.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Technical >> Development >> Re: юмор в этом разделе . ... Re: юмор в этом разделе [ re: nafig_batat ] . ... 10 PRINT "HELLO WORLD" . ... include <stdio.h> . ... public: . ...

Еще в разделе: (Показать все результаты (>1740) - www.snto-msu.net/ )

• MinGW + QT [Windows] траблы с include-директориями - Public forum of MSU united
• Win 2003: Shared Objects (Closed) - Public forum of MSU united student networks
• [C++, Java] many to many object - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Technical >> Development >> Re: юмор в этом разделе . ... Re: юмор в этом разделе [ re: nafig_batat ] . ... 10 PRINT "HELLO WORLD" . ... include <stdio.h> . ... public: . ...

Еще в разделе: (Показать все результаты (>3237) - www.fds-net.ru/ )

• MinGW + QT [Windows] траблы с include-директориями - Public forum of MSU united
• Win 2003: Shared Objects (Closed) - Public forum of MSU united student networks
• [C++, Java] many to many object - Public forum of MSU united student networks

О лаборатории . ... Лаборатория теоретической биофизики . ... This Python module parses Gaussian cube files, produced by quite a few QM software packages, and makes volume data available as numpy array as well as some associated properties. ... Нет комментариев " Gaussian Cube files loader " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>37) - erg.biophys.msu.ru/ )

Inorganic Supramolecular Assemblies and Zintl phases . Our group is interested in synthesis, crystal and electronic structure, and properties of solid state supramolecular and cluster compounds. ... The emphasis is made to the developing of the synthetic routes to the new phases, establishing the interrelationships between crystal and electronic structures, and revealing properties towards the new materials. Inorganic Chemistry Division . Department of Chemistry . ...

Еще в разделе: (Показать все результаты (>36) - www.inorg.chem.msu.ru/ )

• Inorganic Supramolecular Assembl

... Package . Class . ... DimensionSet is an inquiry interface for a collection of Dimensions. Netcdf . ... This abstract class provides a skeletal implementation of the Netcdf interface. ... A Dimension object is used to contain an array length which is named for use in multiple netcdf variables. ... A concrete implementation of the Netcdf interface, this class provides connection to NetCDF version 1 files. ... Interface Netcdf - Extends set of Variable, has a DimensionSet and an AttributeSet. ...

Еще в разделе: (Показать все результаты (>191) - angel.cs.msu.su/ )

• : Class Schema
• : Class AbstractNetcdf
• : Class Attribute

NET .., .. . ... JScript.NET ( VBScript.NET). ... int C/C++, .NET , , ++ ++ , ++. ... public ScriptEngine( string [] assemblyReferences) { GlobalScope gs = VsaEngine.CreateEngineAndGetGlobalScope( false, assemblyReferences); VsaEngine engine = gs.engine; GlobalScope newGS = new GlobalScope(gs,engine); engine.PushScriptObject(newGS); m_GlobalScope = newGS; } // public object Eval( string scriptText) { // object result = null ; return sScript; } // // static void CollectNamespaces( Assembly ...

Еще в разделе: (Показать все результаты (>13) - imaging.cs.msu.ru/ )

... wiki: InterWiki . ... At the extreme, InterWiki prefixes can even be used to simply introduce links to new protocols, such as tsvn: used by тАЛ TortoiseSvn . ... The target Wiki URL is looked up in the InterMapTxt wiki page, modelled after тАЛ MeatBall:InterMapTxt . ... If the following is an excerpt of the InterMapTxt page: = InterMapTxt = == This is the place for defining InterWiki prefixes == Currently active prefixes: [[InterWiki]] This page is modelled after the MeatBall:InterMapTxt page. ...

Еще в разделе: (Показать все результаты (>3034) - kodomo.cmm.msu.ru/ )

• Help: templating

INTERNATIONAL CONFERENCE . February 26 - March 05, 2006, Moscow, Russia . ... Moscow State University . Institute of Mechanics of MSU . ... It follows the tradition of biannual confer-ences organized by the Institute of Mechanics of Moscow State University between 1976 and 2004 (see http://hit2003.narod.ru/ ), which were widely attended by scientists and students from the former Soviet Union. ... Phone, E-mail and Fax. ... Institute of Mechanics, Moscow State University . ...

Еще в разделе: (Показать все результаты (>21) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>181) - www.genebee.msu.ru/ )

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>20) - dynamo.geol.msu.ru/ )

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>23) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... создается некое подобие 3-х мерного пространства Слова показа и и отображены таким же способом. -- param name =example_object_0 value = pltext step =20 font =Verdana:28,3 value =%АППЛЕТ% link = exline :0 color =#009999 param name =example_object_1 value = pltext step =20 shifts=2,2 font =Verdana:28,3 value =%АППЛЕТ% link = ...

Еще в разделе: (Показать все результаты (>43) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer2text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer1text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/cursor/cursor2text1.htm

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458