... 7 (495) 939-16-82 info@physics.msu.ru . ... Education . ... Professor . ... Tel.: ... 7(495)939-31-60; Факс: +7(495)932-88-20 . ... Educational Activities, Complimentary and Continuous Education [ www ] . ... 7(495)939-14-41; Fax: +7(495)932-88-20 . ... Head -- Mrs. Nadezhda Vasil'evna Ryasanova . ... Department of Education . Head -- Associate Professor Gapochka Mikhail Germanovich . ... Department of Graduate and Postdoctoral Studies [ www ] . ... 7(495)932-98-01; Fax: +7(495)932-88-20 . ...

Еще в разделе: (Показать все результаты (>386) - phys.msu.ru/ )

• Физический факультет МГУ им. М. В. Ломоносова

Общее . ... Геология в Московском университете . ... Профком геологического факультета . ... Геологический факультет МГУ всемирно известный учебно-научный центр России. ... Вся деятельность сотрудников факультета направлена на развитие геологической науки, образования и культуры необходимых условий экономического и духовного возрождения России. ... 119991, Российская Федерация, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоносова, Геологический факультет, . ...

Еще в разделе: (Показать все результаты (>146) - geol.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

... Field stations . ... Elbrus station . ... In 1969 a new complex of living and teaching facilities was constructed at the Azau site to support field training of geography students and the year-round studies of glaciers, snow cover, avalanches, mudflows and mountain landscapes. In 1969-1986 the Elbrus station was a part of the Research Laboratory of Snow Avalanches and Mudflows operating as the experimental glaciological center and methodological center of glacier, avalanche and mudflow studies. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Khibiny teaching and research station
• Arkhangelsk (Ustiayansk) station
• Krasnovidovo station

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>26) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation
• Admission committee | MSU Higher school of management and innovation

... MCCMB takes place at the Lomonosov Moscow State University, in the building of Biological Faculty. See the map of the MSU campus with higlighted main points of MCCMB'15 . From each Moscow airport you can reach the city center by train. ... One-way ticket costs 470 rubles (or 530 for train + 1 metro trip).The timetable and details about the train could be found here: http://www.aeroexpress.ru/en/ . ... On every metro station and inside trains there are metro maps both in Russian and English. ...

Еще в разделе: (Показать все результаты (>252) - mccmb.belozersky.msu.ru/ )

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>8) - asa.guru.ru/ )

Faculty of Global Studies, Lomonosov Moscow State Uiversity Information Sheet 2014- 2015 GENERAL INFORMATION University Website Faculty Website for Exchange Students Academic Guide for Exchange Students Mailing Address of the Faculty (for courier delivery as well) Contact Information of the international department of the Faculty http://www.msu.ru/ http://fgp.msu.ru/ http://fgp.msu.ru/ru/ ... The faculty provides exchange students with the dormitory. ...

Еще в разделе: (Показать все результаты (>1606) - fgp.msu.ru/ )

... Winner of joint DAAD (German Academic Exchange Service) and Moscow State University Scholarships Program ?Vladimir Vernadskii? for joint research in Germany. 2011-present. ... 16.11-12.12.2009, Collaborative Research Center 701 of Bielefeld University, Bielefeld, Germany. ... Another ham sandwich in the plane? (joint work with Alexey Balitskiy and Roman Karasev from Moscow Insitute of Physics and Technology), November 9, 2013, Kolloquium Kombinatorik, TU Ilmenau, Ilmenau, Germany. ...

Еще в разделе: (Показать все результаты (>296) - higeom.math.msu.su/ )

• Organisations (Russian)

... Becoming Your Own Boss Many people start a small business in order to enjoy the perceived rewards of freedom and independence. This is understandable because owning your own business can offer you the opportunity to experience freedom: . ... the freedom to earn as much as you want. ... It is fine for you to dream about becoming your own boss some day, however, before you put too much work into your business, make sure that the area you choose is the right one for you. ...

Еще в разделе: (Показать все результаты (>59) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/marketingplanoutline.doc
• http://www.innovation.msu.ru/russian/settingupapaysystem_rus.pdf
• http://www.innovation.msu.ru/english/yourmarketingstrategy.doc

... Andrey A. Mironov [page] . Aleksandra B. Rakhmaninova [page] . Mikhail S. Gelfand [page] . Dmitri D. Pervouchine [page] . ... Lena Stavrovskaya [page] . PhD Students . Dmitriy Vinogradov [page] . ... Yura Korostelev [page] . Katya Khrameeva [page] . ... Undergrad Students . ... SDPpred (Specificity-Determining Positions Prediction) Server [version 0.1] . ... RNA kinetics . Server for multiple alignment of RNA sequences . ... Subscribe to Mironov group meeting . ...

Еще в разделе: (Показать все результаты (>10) - bioinf.fbb.msu.ru/ )

... Parent Directory - Thumbs.db 01-Nov-2010 03:25 8.0K _vti_cnf/ 01-Nov-2010 03:25 - _x_todo.htm 01-Nov-2010 03:25 555 _x_todoh.htm 01-Nov-2010 03:25 557 botinfs.cnf 01-Nov-2010 03:25 146 bots.cnf 01-Nov-2010 03:25 323 deptodoc.btr 01-Nov-2010 03:25 324 doctodep.btr 01-Nov-2010 03:25 114K fpdbw.ico 01-Nov-2010 03:25 1.1K linkinfo.btr 01-Nov-2010 03:25 23K service.cnf 01-Nov-2010 03:25 1.3K service.lck ...

Еще в разделе: (Показать все результаты (>153) - genphys.phys.msu.su/ )

• Index of /rus/edu/kvant/II_2/STAT2/_vti_pvt

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>50) - curl.sai.msu.ru/ )

• curl.sai.msu.ru

Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>230) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/QFTHEP-2010-PopovAV-1.pdf
• http://qfthep.sinp.msu.ru/talks2015/QFTHEP_Fedorov_N_MSU.pdf
• http://qfthep.sinp.msu.ru/proceedings2015/Collider_Volkov.pdf

In Russian . ... Accommodation . Russian Visa . ... Without this card it is impossible to get accommodation. ... metro station . ... to reach the conference place . ... 15 min. by bus . ... 30 min. walk . Single 55 . Double 33 . ... 5 min. by metro . ... Single (improved) 104 . ... Please, inform us in which hotel You would like to stay before December, 1 2004 by e-mail: accommodation@inbox.ru . ... Have You any questions concerning accommodation? ... double . ... single . ...

Еще в разделе: (Показать все результаты (>1762) - chem.msu.ru/ )

• Science Department
• Moscow University Chemistry Bulletin Vol. 51, No. 2, P. 81 (2010)
• Moscow University Chemistry Bulletin Vol. 45, No. 1, P. 38 (2004)

... ICRS (International Celestial Reference System), 1998, . u1 , u3 ­ 1 2000. ... HCRS (Hipparos Celestial Reference Frame), , , 100 . ... ITRS (International Terrestrial Reference System) 1991, , . ... IERS (International Earth Rotation and Reference Systems Service), , (Predicton of Earth Orientation Parameters) . ... TAI (Temps Atomique International) : . ... GPS. ... UTC (Coordinated Universal Time) , . ... TAI UTC 10 2 . ... GPS UTC. ... 3­90.02, , , -, . ... RTK «» 0,5-0,2 , 2400 / 19200 /. ...

Еще в разделе: (Показать все результаты (>471) - chronos.msu.ru/ )

• Laboratory-chair of theory of space-time and interactions
• The Institute for Time Nature Explorations
• Home - Institute for Time Nature Explorations

Schools of Philology, Psychology, and of the Arts, Moscow State University held 1-3 October, 2010 an international conference entitled . FREE VERSE AND FREE DANCE: EMBODIED SENSE IN MOTION . ... In addition to paper sessions and thematic round-table discussions, the conference included master classes in free dance & musical movement training, sessions of vers libres, sound poetry, dance and contact improvisation, and site-specific performances. All master classes were open for participants. ...

Еще в разделе: (Показать все результаты (>6) - discours.philol.msu.ru/ )

... Molecular Mechanics Calculations of beta-Diketonate, Aqua, And Aqua-beta-Diketonate Complexes of Lanthanide Ions Using Gillespie-Kepert Model . ... Abstract - A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. ... For the aqua complexes, typical root-mean-square deviation (calculated vs. ...

Еще в разделе: (Показать все результаты (>45) - analyt.chem.msu.ru/ )

• Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert
• Molecular mechanics study of the mixed-ligand lanthanide complexes using
• Surfactant ion selective membrane electrodes

Вы посетили: englver.html . ... История кафедры . ... Mailing address: Faculty of Algebra, Department of Mathematics and Mechanics, Moscow State University, 119991, GSP-1, Russia, Moscow . E-mail address: guterman at list dot ru . ... Position: Professor at the Moscow State University, Faculty of Algebra, Department of Mathematics and Mechanics . ... Recent invited addresses . ... staff/guterman/englver.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>19) - halgebra.math.msu.su/ )

... List of participants . ... Academician of NAS of Belarus, Professor, Institute for Problems of Natural Resources Use and Ecology . ... Professor, Laboratory of Geoenvironmental Science and Engineering, Cornell University . ... Professor, Dept. of Soil Science and Agrochemistry, Rostov State University . ... Senior Scientist, Dept. of Chemistry, Div. of Organic Chemistry, Lomonosov Moscow State University . ... Professor, Head of Soil Chemistry Chair, Dept. of Soil Science, Moscow State University . ...

Еще в разделе: (Показать все результаты (>194) - mgumus.chem.msu.ru/ )