Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>75) - old.philol.msu.ru/ )

• Human Language - Язык Человека

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... International . ... Partners . ... All partners . ... International media readings . The 6th International Media Readings in Moscow "Mass Media and Communications 2014" . ... Organizers: Faculty of Journalism, Lomonosov Moscow State University . ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>169) - www.journ.msu.ru/ )

• Television and Radio Broadcasting :: Department of Journalism, M. V. Lomonosov
• International Media Management Academic Association's (IMMAA) Annual Conference
• Conferences :: Department of Journalism, M. V. Lomonosov Moscow State

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>8) - npidb.belozersky.msu.ru/ )

• NPIDB: List of complexes

V 9.00-10.35 10.50-12.25 12.40-14.15 14.30-16.05 16.20-17.55 9.00-10.35 10.50-12.25 12.40-14.15 14.30-16.05 16.20-17.55 9.00-10.35 10.50-12.25 12.40-14.15 14.30-16.05 16.20-17.55 9.00-10.35 10.50-12.25 12.40-14.15 14.30-16.05 16.20-17.55 9.00-10.35 10.50-12.25 12.40-14.15 14.30-16.05 16.20-17.55 9.00-10.35 10.50-12.25 12.40-14.15 14.30-16.05 16.20-17.55 2005 «» . . 2109 V 2109 PDF created with pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com

Еще в разделе: (Показать все результаты (>257) - www.geogr.msu.ru/ )

• http://www.geogr.msu.ru/cafedra/soils/uchd/rasp/GOS5.pdf
• http://www.geogr.msu.ru/cafedra/soils/uchd/rasp/GNiG4.pdf

. Photos . This is an old homepage of Sergey Koposov with some old photos. My current homepage is here . The first version of that page was created approximately in november 2002. Sergey Koposov , 2002-2015 . Last change: 30.12.15.

Еще в разделе: (Показать все результаты (>344) - lnfm1.sai.msu.ru/ )

• Trip over old Shanghai
• Manpage of FITSHDR_EDIT
• Data bases of Natural Satellites. Documentation. Structure

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>427) - monkey.belozersky.msu.ru/ )

• DNA/RNA-Protein structures
• PDB entries containing domains of the family "Reverse transcriptase thumb
• PDB entries containing domains of the family "Reverse transcriptase

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Alt >> Hard .Linux >> Re: Новинки программного обеспечения . ... Re: Новинки программного обеспечения [ re: doktork ] . ... Re: Новинки программного обеспечения [ re: bmv ] . ...

Еще в разделе: (Показать все результаты (>2094) - www.snto-msu.net/ )

• Принимаються заказы на зв. карты Creative X-Fi exteme music ret. new - Public
• Re: creative - Public forum of MSU united student networks
• SB Creative ДЕШЕВО - Public forum of MSU united student networks

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... About lab . ... The LidarK library provides an open-source framework for processing multidimensional point data such as 3D LIDAR scans. ... Download LidarK 2.0 , or browse for the previous versions and data samples . ... We called the data structure we designed Seg-Tree . ... GML LidarK Library v. 2.0 September 10, 2010 Download . GML LidarK Library v. 1.2 December 5, 2008 Download . GML LidarK Library v. 1.1 September 9,2008 Download . GML LidarK Library v. 1.0 July 1, 2008 Download . ...

Еще в разделе: (Показать все результаты (>228) - graphics.cs.msu.ru/ )

• GML LidarK Library | Лаборатория компьютерной графики и мультимедиа
• Displacement and Normal Map Creation For Pairs of Arbitrary Polygonal Models
• Creation of cartoons from video | Graphics and Media Lab

DVM-system of parallel program development . Installation guide . ... 1 DVM-system installation under Windows95/NT . ... Microsoft Visual C++ 5.0 version and later (4.0 version can be used with some restrictions, see below); . ... Now the user should copy all files from directory dvm_sys/user to his own directory with DVM programs. ... In this case (but if DVM-system installation was succesfully verified) the user should keep above files with errors and ask for system programmer support. ...

Еще в разделе: (Показать все результаты (>156) - sp.cs.msu.ru/ )

• DVM-system. Installation guide. Version 3.60
• DVM-system. Installation guide. Version 3.30
• DVM-system. Installation guide. Version 3.82

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>34) - observ.pereplet.ru/ )

... BBK 22.6 G 12 UDK 37:[52+53] (076.1) G 12 Gavrilov M.G. / Zviozdnyj Mir: Sbornik zadach po astronomii i kosmicheskoj fizike. ... Here is volume IV – problems of the Olympiads of Scientific Centre in Chernogolovka (former Noginsk Scientific Centre). ... Russian introduction INTRODUCTION Olympiad for high schools students is one of interes- ting traditions of Chernogolovka: a small picturesque villa- ge not far from Moscow, in which the Scientific Center of the Russian Academy of Sciences is situated....

Еще в разделе: (Показать все результаты (>19) - www.issp.ac.ru/ )

• Institutes of Chernogolovka

... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...

Еще в разделе: (Показать все результаты (>19) - algcourse.cs.msu.su/ )

. This page uses frames, but your browser doesn't support them.

55. Laboratory of laser spectroscopy of solutions of supramolecular compounds and

56. JCatalog - Different journal alphabetic indexes

57. Bright Supernova Bright Supernova

58. COMAGMAT MODEL

59. Brief CompHep Installation Instruction

60. "ABOUT RUSSIAN" - журнал о русских людях и их языке