On the 3th of November a report of Drozdov Alexander, manager of Intel Corp. in Russia was presented on the seminar "Mathematics of computers, chips, and electronic circuits". ... Cadence Design Systems, Inc. and Intel, Corp. supports this seminar. ... The main purposes of this seminar are the following: . ... The seminar implements scientific and technical contacts for both domestic and foreign experts in the field of design and use of electronic computing systems. ... Seminar organization: . ...

Еще в разделе: (Показать все результаты (>95) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Zhuk Dmitriy
• Intelligent Systems :: Staff :: Strogalov Alexander Sergeevich :: Modeling

... Sinergetic has recommended itself in the most various areas: to physics, chemistry, biology, and even in public sciences. ... The purpose of research was the study of laws of heat transfer process in active environment, which is nonequilibrium and itself can give the contribution to change of temperature. ...

Еще в разделе: (Показать все результаты (>316) - www.mce.biophys.msu.ru/ )

... Data . ... Models . ... Paraboloid model . ... SHIELDOSE is a model for space-shielding radiation dose calculations. ... Next the index of the detector type is specified, for example '1'. ... The next number indicates the nuclear interaction account, for example 1: . ... The next pair of numbers is about solar protons, the min and max energy of solar protons spectrum, default values are 0.1 and 10000 MeV. ... The next number is the number of spectrum points which divides spectrum for integration. ...

Еще в разделе: (Показать все результаты (>24) - smdc.sinp.msu.ru/ )

... Basic statement: "Mathematics is much clever, than Mathematician" It means, that after the scientist or engineer developed new mathematical model and designed corresponding equations, the solution to these equations produces new information unpredictable for the author! ... This vibration excites the shear wave in tissue 2 sx 2 - (ct + ) s x = Fx 2 t t Studies in Fluid Dynamics of water jet are connected with two main problems: 1. Flows in contracting nozzle forming high-speed jet. ...

Еще в разделе: (Показать все результаты (>45) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/perehody.pdf

Elena Ardashnikova, PhD . ... Ардашникова Е.И., Борзенкова М.П., Новоселова А.В., Изучение системы KF-DyF 3 // Изв. ... Свищев И.М., Ардашникова Е.И., Борзенкова М.П. Новоселова А.В., Способ определения глубины протекания пирогидролиза во фторидах металлов//Авторское свидетельство ?1122963 от 8 декабря 1983, Б.И. ?41, 1984 г. Фадеева Е.Е., Ардашникова Е.И., Поповкин Б.А., Борзенкова М.П., Проблемы фторирования оксидных ВТСП// Ж. неорган. химии, 1993, т.38, ?3, с.389-398. ... 2000, V . ...

Еще в разделе: (Показать все результаты (>91) - www.inorg.chem.msu.ru/ )

• I n o r g a n i c C h e m i s

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>75) - www.geol.msu.ru/ )

... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: detailed packaging two the luxury not (LU . ... a href=http://oakleybus.zohosites.com/><b>cheap oakley sunglasses</b></a> You may find the most affordable Celine bag on our site while high quality can be guaranteed. ... http://www.isabelmarantmybest.com . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>6420) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: luxury detailed consumer 53.6
• Scientific programs and projects: Evaluation of consequences of influences
• Экологический Форум - Фундаментальная Экология: usually be is 80% detailed

... The second half of the 20 th and the beginning of the 21 st century have witnessed an unprecedented increase in the rate of new mineral discoveries, as a result of which the overall mineral system has grown from 2000 to more than 4000 species in a relatively short time. ... Almost all of the new minerals from the Kola region were discovered in ore deposits related to three types of alkaline rock associations: agpaitic nepheline syenite massifs, carbonatite-bearing complexes, and alkaline granites. ...

Еще в разделе: (Показать все результаты (>892) - geo.web.ru/ )

• Harvard Seismology: 3-D Earth Structure

MRI of teeth contours in articulation processes G. Kedrova, N. Anisimov, L. Zaharov, O. Nikolaev Moscow State Lomonosov University Abstract The research is focused on experimental methods and technology for detailed MR-visualization of solid calciferous tissue boundaries (i.e. teeth and adherent bony structures) and estimation of overall resonance shape throughout the speech production process. ...

Еще в разделе: (Показать все результаты (>364) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/fdsl/FDSL7.5-stylesheet.doc
• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/2001/specom01.doc
• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/files/Communicative_intentions@Odessa_2008.pdf

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>59) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/staff/elbel.php
• http://cryst.geol.msu.ru/courses/crchem/urusov1.pdf

... There are two methods of describing plant associations of the lake-shore: visual and analytical. ... We analyzed each lake separately with help of cluster analysis (Manchattan distance, Ward method). ... Besides, cluster analysis only for common plant species was performed. ... All common species on this lake form one multitudinous cluster (fig. 5), except for Comarum palustre and Equisetum fluviatile (the same group of species reveled by cluster analysis for common species from other lakes). ...

Еще в разделе: (Показать все результаты (>248) - herba.msu.ru/ )

• Flowers: Diversity, Development and Evolution
• Corallina officinalis: detailed view
• Enteromorpha intestinalis: detailed view

... Reduction of detailed schemes for chemical transformations of formaldehyde and hydrogen oxidation reactions based on a sensitivity analysis of a mathematical model" . ... The results of simulation are compared in the case of using a number of reduced and detailed schemes for formaldehyde and hydrogen oxidation reactions. Keywords: sensitivity analysis, mathematical model of reaction, formaldehyde oxidation reaction, hydrogen oxidation reaction, reduction of chemical reaction mechanisms. ...

Еще в разделе: (Показать все результаты (>401) - num-meth.srcc.msu.ru/ )

• "Speeding up the solution of coupled heat transfer problems on unstructured
• "Complex supercomputer benchmarking"
• "Optimization algorithms for facet models and methods of their network...

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>229) - www.genebee.msu.ru/ )

• GeneBee service
• Biochemistry (Moscow), Vol
• Screening pattern or alignmemt against PROTEIN databank

... Study (Michael & Houchin 1979) is an example of one of the first nonparametric approaches to EEG segmentation. ... As we noted, the main disadvantage of this approach to segmentation was the lack of adaptability of segment boundaries to the actual piecewise stationary structure. ... One may also expect that the change-points can reveal the consecutive operations of neuronal networks, with different time scales according to parameters of the algorithm of change-point detection (Kaplan et al. 1997b). ...

Еще в разделе: (Показать все результаты (>65) - brain.bio.msu.ru/ )

• Parametric segmentation of the EEG
• Change-point synchronization between signals or signal components
• Change-points in EEG components with different pattern

... V.V.Shevchenko, Sternberg State Astronomical Institute, Moscow University, Universitetsky 13, Moscow 119899, Russia, shev@sai.msu.ru . ... 1.Sternberg State Astronomical Institute, 119899, Moscow, Russia. shev@sai.msu.ru . ... V.V.Shevchenko, Sternberg State Astronomical Institute, Moscow University, Moscow 119992, Russia, shev@sai.msu.ru . ... 119992 Moscow, Russia; . ... 2Sternberg Astronomical Institute, Moscow University, Moscow, 119992, Russia, . ... Moscow, 119992, Russia shev@sai.msu.ru . ...

Еще в разделе: (Показать все результаты (>107) - selena.sai.msu.ru/ )

• Symposium

... Menzerath's Law for Morphemic Structures of Words: . A Hypothesis for the Evolutionary Mechanism of its Arising and its Testing . Anatoliy A. Polikarpov . ... Key words: Menzerath's Law, morphemic structures, language evolution . ... In this paper there is present (1) a hypothesis for understanding the evolutionary mechanism responsible for the Law arising and (2) some data for testing the hypothesis. ... A Hypothesis. ... Altmann, G. Prolegomena to Menzerath's Law//Glottmetrika 2. ...

Еще в разделе: (Показать все результаты (>68) - old.philol.msu.ru/ )

• Footnotes
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics

... x25BA; Site pages . x25BA; Calendar . x25BA; April 2016 . Detailed month view: . x25C4; March 2016 | May 2016 x25BA; . ... Global events shown ( click to hide ) . Course events shown ( click to hide ) . Skip Events key . ... Course Skip Monthly view . ... Mon . ... Fri . ...

Еще в разделе: (Показать все результаты (>3) - moodle.ffl.msu.ru/ )

Diploma thesis abstract «Subwavelength structures influence on plasmon waves propagation in terahertz frequency range» Done by 6th year student Ryabov A.Y. Research supervisor: PhD, Angeluts A.A. In this diploma a propagation of the plasmon waves along metal surface is investigated in the THz frequency range. The metal surface contains the sub-wavelength structures. ... In addition spectral transmission characteristics of the sub-wavelength structures were predicted. ...

Еще в разделе: (Показать все результаты (>167) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2015/Semenov_Shlenov_en.pdf
• Laboratory of solid-state lasers and coherent spectroscopy

New Scientist 12 2011 2795, . ... New Scientist , . ... 1988 , (. ... Nature ( 333, P 816) 1988 , , "", , (New Scientist, 14 1988 , . ... Nature " " , . ... New Scientist Scorn over claim of teleported DNA 12 January 2011 by Andy Coghlan Magazine issue 2795, pp. ... Luc Montagnier, who shared the Nobel prize for medicine in 2008 for his part in establishing that HIV causes AIDS, says he has evidence that DNA can send spooky electromagnetic imprints of itself into distant cells and fluids. ...

Еще в разделе: (Показать все результаты (>473) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/kiefer_fqx.pdf
• http://temporology.bio.msu.ru/EREPORTS/shulman_time.pdf
• http://temporology.bio.msu.ru/EREPORTS/anisov_time.pdf

Theory as a Lighthouse in the Electrochemical Ocean . In memory of Alexander M. Kuznetsov . ... Until his last days he continued to work on various aspects of charge transfer phenomena. ... In electrochemical kinetics the theory always outruns the experiment, and the quantum mechanical theory of charge transfer created in the famous Theoretical Department of the Frumkin Institute in Moscow (R.R. Dogonadze, A.M. Kuznetsov and co-authors) is a good example for that. ...

Еще в разделе: (Показать все результаты (>91) - electr003.chem.msu.ru/ )