English version] [Pyc.- ... The laboratory was founded in 1991, when Cellulase Research Group at the Division of Chemical Enzymology, M.V.Lomonosov Moscow State University, received the status of laboratory. From the moment of establishment of the Division of Chemical Enzymology in 1974 by Professor Ilya Berezin, Cellulase Research Group was led by Dr. Anatole Klyosov. ... Enzymology, biochemistry and biotechnology of enzymes catalyzing the biodegradation of polysaccharides: . ...

Еще в разделе: (Показать все результаты (>112) - www.enzyme.chem.msu.ru/ )

• Cellulase lab Russian version
• PubMed medline query

... BLG 109: A Distant Version of our own Solar System . ... Perhaps quite common, as the first system of planets like our own Solar System has been discovered using a newly adapted technique that, so far, has probed only six planetary systems . ... Pictured above is an artistic conception of how the BLG-109 planetary system might look. ... Publications with keywords: Solar System - microlensing - extrasolar planet . Publications with words: Solar System - microlensing - extrasolar planet . ...

Еще в разделе: (Показать все результаты (>2740) - www.astronet.ru/ )

• Астронет > BLG 109: A Distant Version of our own Solar System
• Journal "Peremennye Zvezdy"
• Астронет > Венера возвращается на вечернее небо

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>25) - seac47-2.phys.msu.ru/ )

• Administration

You are here: Foswiki > System Web > ReferenceManual > DeveloperDocumentationCategory > PerlDoc (19 Apr 2011, ProjectContributor ) E dit A ttach . ... parsePatch($file ) -> %patch{filename} . ... updateFile($file, $patch, $reverse ) . ... Each patch file can patch one or more files. ... md5_of_target} = Will match the file version that can accept this patch. {patched} = Expected MD5 of the patched file. {version} = Comment from PATCH record describing the target. ... Patch target . ... Applies to . ...

Еще в разделе: (Показать все результаты (>18753) - wiki.cs.msu.ru/ )

• (backlinks in System Web) JQueryMetadata < System < Foswiki
• (backlinks in all Webs) JQueryMetadata < System < Foswiki
• HistoryPlugin < System < Foswiki

Support ] [ Links to DC resistivity and IP software in WWW ] . ... TRF_2D for Windows - Automated 2D Inversion Program for VES Travers Data. ... The scientists of the laboratory are developing algorithms and computer programs for decision of forward and inverse problems of resistivity and induced polarization methods, which are widely known in Russia and are applied in many countries abroad. ... IE2DL - the set of the programs for resistivity and IP data modeling in 2D inhomogeneous media . ...

Еще в разделе: (Показать все результаты (>52) - geophys.geol.msu.ru/ )

• Theory of resistivity sounding
• IPI2win - 1D interpretation of VES profile.
• Links of engineering geophysics and software

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>61) - old.philol.msu.ru/ )

• HumLang Russian version

... Default layout: a simple list of topic revisions using the default format (see below) . ... Topic name, can be in web.topic format . ... versions="number or range" . ... To get version 2, write: versions="2" . ... header="text" . ... May contain the tokens $next and $previous which will be evaluated if there are newer or older revisions available for the topic that are not listed according to versions (or rev1 , rev2 , nrev ). ... This topic: System > Plugins > HistoryPlugin > VarHISTORY . ...

Еще в разделе: (Показать все результаты (>33644) - wiki.cmc.msu.ru/ )

• (backlinks in all Webs) JQueryMetadata < System < Foswiki
• (backlinks in System Web) JQueryMetadata < System < Foswiki
• HistoryPlugin < System < Foswiki

Schools of Philology, Psychology, and of the Arts, Moscow State University held 1-3 October, 2010 an international conference entitled . FREE VERSE AND FREE DANCE: EMBODIED SENSE IN MOTION . ... In addition to paper sessions and thematic round-table discussions, the conference included master classes in free dance & musical movement training, sessions of vers libres, sound poetry, dance and contact improvisation, and site-specific performances. All master classes were open for participants. ...

Еще в разделе: (Показать все результаты (>3) - discours.philol.msu.ru/ )

English version . department presentation . ... Кафедра . ... The Department of Foreign Literature was found in the Moscow University in 1863 (although, the courses of Western belles-lettres were given at the Philological Department since the late 18th century) and has subsisted till the 1920s when the study of foreign literature was scrapped from the reorganized University structure. ... The Department publishes works in Russian and foreign languages. ... Department of foreign literature. ...

Еще в разделе: (Показать все результаты (>315) - www.philol.msu.ru/ )

• LangueDOC :: Movie
• LangueDOC :: Tools
• Created by Camtasia Studio 6

Infrastructure for statistical education . Since 2003 the UIS RUSSIA team concentrates at statistical domain aiming to implement an infrastructure for statistical education and evidence-based applied analysis and full scale social and economic investigations. The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>78) - srcc.msu.ru/ )

• Alexander V. Tikhonravov, Tatiana V. Amotchkina, Michael K. Trubetskov, Robert
• Tatiana V. Amotchkina, Michael K. Trubetskov, Vladimir Pervak, Boris Romanov,

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>26) - www.socio.msu.ru/ )

• Вестник МГУ
• Главная - Социологический факультет МГУ

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>26) - uranus.sai.msu.ru/ )

• Anatol Cherepashchuk
• Igor Antokhin
• Eugene Trunkovsky

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Pink Floyd - The Wall DVD-version . ... Re: Pink Floyd - The Wall DVD-version [ re: Zx48k ] . ... Re: Pink Floyd - The Wall DVD-version [ re: Alter_Grin ] . ...

Еще в разделе: (Показать все результаты (>5434) - www.snto-msu.net/ )

• Open MSU Dota Championship, 3x3 Beer Unlim. Version - Public forum of MSU
• .net Framework опять косячит:( - Public forum of MSU united student networks

LABORATORY OF NUCLEIC ACID-PROTEIN INTERACTIONS . ... Study of Natural Covalent Complexes of Nucleic Acids and Proteins . ... High sensitive tools and methods are developed in the laboratory for detection and identification of the viral and cellular nucleic acids and covalent complexes of RNA and proteins that contain the covalent linkage unit (CLU), which is identical to the CLU of the picornavirus VPg-RNA covalent complex. ... Antibodies against picornavirus RNA-VPg covalent linkage unit . ...

Еще в разделе: (Показать все результаты (>185) - www.genebee.msu.ru/ )

• BLAST Basic Overview
• Selected Scientific Journals - How to link to us
• Center of Molecular Medicine

... Class . ... public class NetcdfFile . ... A concrete implementation of the Netcdf interface, this class provides connection to NetCDF version 1 files. ... NetcdfFile (java.io.File file, boolean clobber, boolean fill, Schema template) . ... Constructor Detail public NetcdfFile (java.io.File file, boolean clobber, boolean fill, Schema template) throws java.io.IOException . ... public NetcdfFile (java.lang.String path, boolean clobber, boolean fill, Schema template) throws java.io.IOException . ...

Еще в разделе: (Показать все результаты (>82) - angel.cs.msu.su/ )

• : Class ConcreteIndexMap
• Appendix B File Format Specification

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>117) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Faculty of Geology >> Departments
• Faculty of Geology >> Geology at Moscow State University

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>10) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

... Главная . ... О кафедре . ... Здесь Вы можете получить самую разнообразную информацию о кафедре, ее сотрудниках, курсах лекций, познакомиться с историей кафедры. ... Числовые и нечисловые поля. 24 сентября в 15.20 состоится заседание -- научный семинар кафедры математики. ... Студентов младших курсов: информация о кафедре, темы курсовых работ.. Сотрудников кафедры: описание курсов, материалы (задачи, контрольные вопросы) .. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>475) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова |
• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши
• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная

Unfortunately, the English version of our site is much less developed than the Russian version. ... Library of Electronic Publications . ... The Institute for Time Nature Explorations web site is established by the Russian Interdisciplinary Temporology Seminar , which has been operating at M. V. Lomonosov's Moscow State University since 1984. The creation and continued maintenance of the institute were and are made possible through the support of the Russian Fund of Basic Research, grant No. ...

Еще в разделе: (Показать все результаты (>394) - chronos.msu.ru/ )

• Home - Institute for Time Nature Explorations
• Institute Laboratory-Chairs