... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>109) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

Next: Scientifically discovered God Up: No Title Previous: Simple Universe . ... As a matter of fact, it stands already for several centuries. ... The characteristic time, t , of civilization development, was known already. ... Indeed, the expansion of the Universe was not yet discovered, and, the Universe was believed to be eternal! ... If the Universe has lived for an infinitely long time then the Tsiolkovskii's paradox can be solved only with this key, the key of ``Superintelligence''. ...

Еще в разделе: (Показать все результаты (>263) - xray.sai.msu.ru/ )

• Case B: #tex2html_wrap_inline768#
• Super Ratio
• Wolf-Rayet and He stars (stage IV)

. ADDRESS/EMAIL . To receive the complete Announcement and Call for Papers, please contact with ISNA organizing committee . ISNA-16 . Department of Acoustics . Physics Faculty . Moscow State University . 119899 Moscow . Russian Federation . Web: http://acs366b.phys.msu.su/isna16 .

Еще в разделе: (Показать все результаты (>63) - acs366.phys.msu.su/ )

• Abstract

. If you are interested in attending the conference, kindly complete the following form. Initials : . Title : . Sex : . Male Female . First (Personal) Name : . Family Name : . Company/Organization/Institution : . Postal Address : . Email : . Phone (Full International) : . Fax (Full International) : . Passport Details and date of Expiry : . I intend to present . An oral presentation Preliminary title: . A poster Preliminary title: .

Еще в разделе: (Показать все результаты (>159) - www.fadr.msu.ru/ )

• Abstracts
• "EcoPhoto" - Order photo - CD
• Фотоархив "EcoPhoto" - Заказ фото - CD

... Departments . ... Head of the department: Moiseev Evgeny, Academician of RAS, Professor, Dr. Sc., Dean of the Faculty CMC MSU Contact information . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. ... Functional Analysis by Assoc. ...

Еще в разделе: (Показать все результаты (>258) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>8983) - kodomo.fbb.msu.ru/ )

• allpy: 6507cd6808c7 debian/control.in
• allpy: 1e5116ce9d75 debian/control.in
• allpy: 40c086a41ca0 debian/control.in

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>11) - iconolat13.phys.msu.ru/ )

extra:model:main ]] . CompHEP . ... Please address any questions concerning models to their authors. Authors of a model keep all rights. Any CompHEP user may apply a model respecting conditions defined by the authors. ... Model ==== ** Model description ** * Name: modelname * Author: modelauthor * Short description: * Long description: see [[http://www.univ.com/author/auth|modelauthor]] * {{http://comphep.sinp.msu.ru/extra/model/auth.zip|auth.zip}}, 123KB * References: - ref 1 - ref 2 .. ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

• downloads [CompHEP]
• bugs:main [CompHEP]
• faq [CompHEP]

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>298) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>56) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... The first version of the nucleus of Linux operating system was written more than 20 years ago by a student, just like you, as his second-year coursework. ... Sekunov N. Programming on C++ in Linux. ...

Еще в разделе: (Показать все результаты (>52) - engineering.phys.msu.ru/ )

... We obtained 20 complete cytochrome b sequences (1140 bp) of Meles leucurus from the Korean Peninsula (mainland Korea and Jeju Island), Russian Far East, and Mongolia, and these sequences were compared to complete and partial (629 bp) sequences of M. leucurus , obtained from GenBank, in order to reexamine genetic differentiation among M. leucurus from Korea, Siberian and Far-eastern Russia, Mongolia, and China. ...

Еще в разделе: (Показать все результаты (>1049) - zmmu.msu.ru/ )

• Two sympatric phylogroups of the Asian badger Meles leucurus (Carnivora:
• Global fossil bat records - abstract
• Order Chiroptera

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>283) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/ongoing_projects.html

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Почти) полный список публикаций ((Almost) complete list of publications) . ... Список работ под редакцией (List of publications under editing) . ... D. V. Georgievskii, M. V. Shamolin and Prof. of Bauman Moscow Technical University S. A. Agafonov (Scientific Seminar "Actual Problems in Geometry and Mechanics" under research advising of Profs. ... If you have any questions send me e-mail to: shamolin@imec.msu.ru , shamolin@rambler.ru , shamolin.maxim@yandex.ru . Inmech Main Page . ...

Еще в разделе: (Показать все результаты (>36) - shamolin2.imec.msu.ru/ )

Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>35) - hea.phys.msu.su/ )

• Call for Papers

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>56) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

University Satellites and . Space Science Education . ... Best Free Tube Porn http ://nativemusicenthusiast.com/ members /shakiranude.aspx shakira nude , ( http ://nativemusicenthusiast.com/ members /shakiranude.aspx - shakira nude ) , http ://segrich.com/ Community / members /hillaryscottnude.aspx hillary scott nude , ( http ://segrich.com/ Community / members /hillaryscottnude.aspx - hillary scott nude ) , http ://nativemusicenthusiast.com/ ...

Еще в разделе: (Показать все результаты (>6703) - cosmos.msu.ru/ )