Space Scientific and Education project of Lomonosov Moscow State University "MSU-250" is timed to its 250-th annversary. ... Scientific program is directed to the studies of the space physics problems. It includes development and launch of two supersmall satellites intended mainly to the studies of the radiation conditions in the near-Earth space. ... The conference "University Satellites and Space Science Education" (UNIVERSAT-2006) was held in Moscow on June 26-30, 2006. ...

Еще в разделе: (Показать все результаты (>106) - cosmos.msu.ru/ )

... На сайте кафедры Общих проблем управления выложены конспекты лекций профессора М.И. Зеликина по курсу "Вариационное исчисление и оптимальное управление" за 2015 г. http://new.math.msu.su/department/opu/node/358 . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ... Old version of the GPC departent sito ...

Еще в разделе: (Показать все результаты (>133) - new.math.msu.su/ )

• Protasov Vladimir Yuryevich | Department: General Problems of Control. Faculty
• Официальный сайт механико-математического факультета МГУ имени М.В.Ломоносова
• Scientific directions | Department: General Problems of Control. Faculty of

On problem of interpretation and forecasting space-temporary variations of geophysical fields on results of deep scientific drilling Esipko O.A., Kolbasova A.V., Rosaev A.E. In the process of boring the deep bore holes, as scientific, so and industrial one's living, and when processing the received results, the problem of large arrays of data analyses appears. ... The example of geophysical data development As an example of with depth and variation log data with 0.2 meters of (verified) data. ...

Еще в разделе: (Показать все результаты (>64) - acat02.sinp.msu.ru/ )

... O.B. Arushanian, S.F. Zaljotkin, and N.N. Kalitkin . A number of test problems for program performance evaluation in the field of ordinary differential equations (the case of Cauchy problem) are proposed. ... PostScript (in Russian) (129KB) . PDF (in Russian) (121йB) . PostScript. zip (in Russian) (40йB) . PDF. zip (in Russian) (51йB) . O. B. Arushanian, S. F. Zaljotkin e-mail: arush@srcc.msu.ru . N. N. Kalitkin e-mail: kalitkin@imamod.ru ...

Еще в разделе: (Показать все результаты (>602) - num-meth.srcc.msu.ru/ )

• "A three-level MPI+NUMA+Threads method for constructing parallel programs to
• "The source control in the problem of heat conduction"
• "Parallel algorithms for solving the inverse gravity problem and the distant

Home :: Seminar in Polymer Physics :: 1999 . ... S.S. Sheiko (Lab. of Organic Chemistry/Macromolecular Chemistry, University of Ulm). ... A. N. Ivanova, L. I. Manevich (Institute of Problem of Chemical Physics). ... S. I. Kuchanov, T. S. Zharnikov (Institute of Applied Mathematics, RAS, Moscow). ... October 20: L. V. Nikitin (Moscow State University, Physics Department) . ... June 1: N.K.Balabaev, O.B.Gendelman, L.I.Manevich (Institute of Chemical Physics,RAS, Moscow) . ...

Еще в разделе: (Показать все результаты (>186) - polly.phys.msu.ru/ )

• Conferences

Status of the project NICA / MPD at JINR A.N.Sissakian, A.S.Sorin Scientific Workshop dedicated to the centenary of V.I.Veksler's birth and the 50th anniversary of launching the Synchrophasotron JINR , Dubna, October 10 - 12, 2007 heat compression NI CA FAIR GSI, NICA JINR NICA goals and physics problems Study of in-medium properties of hadrons and nuclear ...

Еще в разделе: (Показать все результаты (>155) - nuclphys.sinp.msu.ru/ )

• E.L.Fainberg (right) International Seminar on high-energy physics problems,

... Score E Sequences producing significant alignments: (bits) Value EP31007 (+) Hs HMG-14; range -9999 to 6000. 68 2e-11 EP02025 (+) Os AK060876; range -9999 to 6000. ... 32 1.0 EP12507 (+) Os AK060693; range -9999 to 6000. 32 1.0 EP12371 (+) Os AK059451; range -9999 to 6000. 32 1.0 EP11961 (+) Os AK120318; range -9999 to 6000. 32 1.0 EP10967 (+) Os AK068200; range -9999 to 6000. 32 1.0 EP10028 (+) Os AK108849; range -9999 to 6000. ... 30 4.1 EP13232 (+) Os AK064643; range -9999 to 6000. ...

Еще в разделе: (Показать все результаты (>5502) - kodomo.cmm.msu.ru/ )

testparm - check an smb.conf configuration file for internal correctness . testparm [ -s ] [ configfilename ] [ hostname hostIP ] . This program is part of the Samba suite. testparm is a very simple test program to check an smbd configuration file for internal correctness. ... Note that this is NOT a guarantee that the services specified in the configuration file will be available or will operate as expected. ... This is usually the name of the configuration file used by smbd . ...

Еще в разделе: (Показать все результаты (>806) - oit.cmc.msu.ru/ )

• Network Functions
• Problems?
• hw_GetObject

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>32) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

The preliminary program . of the International Congress . Russian Language: . ... Problems of historical Russian linguistics within Common Slavic and Indo-European context: inheritance, development, cultural contacts. ... Dynamic picture of modern Russian language synchrony . ... Stable features of modern Russian public language: factors and tendencies of the development of its means and genres. ... New features and aspects of Russian fiction language of the end of XX-th century research. ...

Еще в разделе: (Показать все результаты (>393) - www.philol.msu.ru/ )

• Sample linguistic problems :: МГУ :: Филфак :: ОТиПЛ
• II International Congress of Russian Language Researches - Information letter
• Department for Discourse and Communication Studies - Events

What are the common problems with threads? ... In many other multithreaded OSs, threads are not processes merely parts of a parent task. Therefore, the question of "what happens if a thread calls fork() or (worse) if a thread execve()'s some external program" becomes problematic: the whole task could be replaced. ... In fact, some multitasking OSs have opted not to support threads due to these problems (not to mention the effort needed to make the kernel and libraries 100% reentrant). ...

Еще в разделе: (Показать все результаты (>674) - rtm-cs.sinp.msu.ru/ )

• Linux Meta-FAQ
• Issues Regarding DNS and Apache
• Firewall Piercing mini-HOWTO

GMATCH . That projects is aimed for the solution of the well known problem of all observational astronomers -- the WCS alignement of the images. It is always great to have the possibility to determine the exact J2000 coordinates of each point of the frame. It is always great to not manually align the images before summing them. My program is aimed to solve all those problems. ... Download . ... WCSLIB library (by M. Calabretta)(download from here ) . ...

Еще в разделе: (Показать все результаты (>363) - lnfm1.sai.msu.ru/ )

• New sats of Uranus - Sources
• Scientific activity
• IDL programs

... P hysics Faculty, Moscow State University, . ... Moscow State University, Physics Faculty, Diploma work in Hydrodynamics . ... Title: «Dynamical Stochasticity of Nonlinear Systems and a Prediction Problem» . ... The First International School-Conference BILLIARDS’09 – « Mathematics and Physics of Billiard-Like Systems », February 16-19, 2009, guas de Lindoia, SP, Brazil . ... Invited Lectures «Chaos in Dynamical Systems», The Space Research Institute, Russian Academy of Science, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>78) - chaos.phys.msu.ru/ )

• Science

... allpy.fileio: switched to using iterator-based read methods everywhere. ... Markup ): . ... 6 def from_record ( cls , container , record , name = None ): . ... 8 result = cls ( container , name = name ) . ... 17 def to_record ( self ): . ... 29 def refresh ( self ): . 30 for number , monomer in enumerate ( self . ... 31 monomer . ... 38 for index , monomer in enumerate ( self . ... 59 name = 'case' . ... 62 for monomer in self . ... 75 assert len ( markup ) == len ( result . ... 87 case = self . ...

Еще в разделе: (Показать все результаты (>13518) - kodomo.fbb.msu.ru/ )

• allpy: d16e8559b6dd allpy/fileio.py
• allpy: f0b66ad47b11 allpy/markups.py
• allpy: cbad560dc3cb allpy/markups.py

... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...

Еще в разделе: (Показать все результаты (>2) - icho39.chem.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>5) - composite.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Gamma-bursts . ... Scientific equipment . ... ShOK . ... Program of the experiment . ... ShOK device consists of two stationary fast wide-angle cameras. Their field of vision is situated within the area of gamma-bursts? detection of other instrumentation onboard ?Lomonosov? satellite. ... It must be emphasized that ShOK device will be the first orbital experiment with cameras of super-wide field. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• IMISS-1 | Университетский спутник "Ломоносов"
• BDRG | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"

Stephanorhinus kirchbergensis . Records of Stephanorhinus kirchbergensis (Jager, 1839) (Mammalia, Rhinocerotidae) from the Obв?T River at Krasny Yar (Tomsk region, southeast of Western Siberia) . ... First records of Stephanorhinus kirchbergensis (Jager, 1839) (Mammalia, Rhinocerotidae) from the Kuznetsk Basin (Kemerovo region, Kuzbass area, South-East of Western Siberia) // Bolletino della Societa Paleontologica Italiana. ...

Еще в разделе: (Показать все результаты (>1365) - zmmu.msu.ru/ )

• New remarkable bat records in Hoang Lien Son mountain range, northern Vietnam
• Global fossil bat records - abstract
• New record of anchithere (Anchitherium aurelianense) in the Miocene of Eastern

CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...

Еще в разделе: (Показать все результаты (>30) - www.inorg.chem.msu.ru/ )

• Group of Hydrothermal Synthesis :: News

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>29) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры