.

Еще в разделе: (Показать все результаты (>64) - www.chemport.ru/ )

• Ukrainian power generation 1.рынок электроэнергии рф электроэнергетика украины

. WINAMP . playlist . 11 tracks in playlist, average track length: 44:56 . Playlist length: 8 hours 14 minutes 19 seconds . Playlist files: DJ Skinner-Purple rose . m-NuClEaR - gobble-mix. HH2!!s . Nuclearsound . prick . m-NuClEaR - remember stritz . set . threedays . tssf-05171999-m3-gabbergirl . tssf-19990222-gabbergirl . tssf-19990422-Ozone-3-Gabbe . tssf-19990531-m3-gabbergirl . tssf-19991001-switchcraft-vandenbroek-56k . tssf-19991004-mcubed-gabbergirl . tssf-1999-djspree-mixtapeAside .

Еще в разделе: (Показать все результаты (>10) - optics.sinp.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... The script generates nanotubes of arbitrary structure. ... To use it, save script to some file, then load into PyMol with the command: run /path/to/script.py . ... Here comes the script : # Nanotubes generating script for PyMol by piton at erg .biophys.msu.ru import cmd from math import cos,sin,pi,ceil,floor, acos from chempy import models, cpv class cell: def __init__(self ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>26) - erg.biophys.msu.ru/ )

• gromacs ERG Research Group: Лаборатория теоретической биофизики
• Peter Mamonov ERG Research Group: Лаборатория теоретической биофизики
• pymol ERG Research Group: Лаборатория теоретической биофизики

Schedule : Nonlinear Acoustics of the Atmosphere, the Ocean, and the Earth . ... Nonlinear Models of Waves in Granulated Partially Wet Media . ... Petukhov M. The Parametric Generation of Magnetic-Acoustic-Gravity Waves in an Atmosphere . ... Kovalevsky V. V. Modeling of the Process of Interaction of Infrasonic Acoustic and Seismic Waves . ... Kovalevsky V. V. Mathematical Problems of Generation and Interaction of Acoustic and Seismic Waves From Vibrational Sources . ...

Еще в разделе: (Показать все результаты (>233) - acs366.phys.msu.su/ )

• Abstract
• Nonlinear Acoustics of the Atmosphere, the Ocean, and the Earth

... Для этого воспользуемся базой данных PDBSum и со страницы своей структуры пройдем по гиперссылке "PROCHECK" (слева). ... Gly and Pro) 73 Glycine residues 15 Proline residues 10 ---- Total number of residues 260 . Ни один остаток не попал в разрешенную или запрещенную области. ... В предпочитаемой - 155 остатков. ... Пройдем по гиперссылке "Significant regions" Большой Z-score по RSR имеет только три остатока цепи B: 92 ILE(изолейцин) RSR=0,262; . ... 94 GLY(глицин) RSR=0,441; . ...

Еще в разделе: (Показать все результаты (>2569) - kodomo.cmm.msu.ru/ )

• Task 9, term 5

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DiMMon: a New Approach to Supercomputer Monitoring . ... Kazan National Research Technological University . ... AREA: Physical Chemistry, Optics and Quantum Electronics . ... Moscow State Uiversity . DRIVER: Supercomputer-aided development of new mid-infrared laser technologies. ... AREA: Optics and Quantum Electronics . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>34) - hpc.msu.ru/ )

• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing
• APPLICATIONS: Radiophysics | Moscow University Supercomputing Center
• APPLICATIONS: Fundamental Medicine and Phisiology | Moscow University

... Архив семинара . ... Triggered Star Formation" . It is now well established that massive stars in star forming regions can trigger next generation of star formation. ... The young stellar objects (YSOs) in star forming regions have been identified using the near-infrared (NIR) and mid-infrared (MIR) observations. ... The age of YSOs, the morphology of the regions and the global distribution of YSOs indicate that the star formation can be triggered by either (RDI/ CC) of the processes. 40 мин. ...

Еще в разделе: (Показать все результаты (>136) - lnfm1.sai.msu.ru/ )

Microbial composition and metabolic potential development in microbial fuel cells during wastewater treatment Olga Tsoy Institute for Information Transmission Problems (Kharkevich Institute ), Bolshoy Karetny per. 19, build.1, Moscow 127051 Russia Okinawa Institute of Science and Technology, 19191 Tancha, Onnason, Kunigamigun, Okinawa , Japan 9040495 tsoy.v.olga@gmail.com Larisa Kiseleva Okinawa ... To estimate the biodiversity in MFC samples we used Metaxa 2 for small rRNA prediction. ...

Еще в разделе: (Показать все результаты (>285) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/147.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/106.pdf

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

• download:rn-080423 [CompHEP]
• overview [CompHEP]
• download:rn-070606 [CompHEP]

Biology Bulletin of the Russian Academy of Sciences . ... A hypothesis is proposed on generating flows of proelements in deep layers of the matter structure, with respect to which our Universe is not closed and isolated. ... Answers can be sought by attracting attention to the deep levels of natural hierarchies, whose elements are not standard molecular components of the systems, such as electrons, nucleons, quarks, etc. ... There are generating flows of elements at the deep levels of the system. ...

Еще в разделе: (Показать все результаты (>395) - chronos.msu.ru/ )

• A.P.Levich. What we expect from studying time
• Laboratory-chair of modelling the natural references of time
• Russian Interdisciplinary Temporology Seminar

... Fiber optic hidrophones . ... A fiber optic air backed mandrel hydrophone to detect high energy hadronic showers in the water". ( text ) . ... The realization of an optic fiber air backed mandrel hydrophone for frequencies up to 20 kHz". ( text ) . M. Anghinolfi, A. Bersani, A. Calvi, A. Cotrufo, M. Ivaldi, O. Ershova, F. Parodi, D. Piombo, A. Plotnikov and L. Repetto "Measurement of the frequency responsivity of a fiber optic air backed mandrel hydrophone up to 10 kHz in air". ( text ) . ...

Еще в разделе: (Показать все результаты (>8) - antares.sinp.msu.ru/ )

... Форумы > Разное > Тема . ... Состоялся финал международной студенческой конференции 'IT Security for the Next Generation'. Состоялся финал международной студенческой конференции 'IT Security for the Next Generation '. 13-15 апреля в Мюнхене состоялся финал международной студенческой конференции 'IT Security for the Next Generation ', который объединил победителей всех 3-х региональных отборочных туров (Европейского, Азиатско-Тихоокеанического региона, Ближнего ...

Еще в разделе: (Показать все результаты (>112) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>35) - shg.phys.msu.ru/ )

• Milestones of the lab highway
• CURRICULUM VITAE
• Nick's Homepage

... After checking with Australian-based colleagues on current and recent . ... geology and soil science. ... I was an active member of the Australian Committee for Stratigraphic . Nomenclature. ... incorporate into the Australian Code of Stratigraphic Nomenclature the . ... mappable unit mantle of soil (a soil stratigraphic unit), with provision . ... As conceptual stratigraphic units, paleosols are analogous to (but . ... stratigraphic units in the Australian stratigraphic code. ...

Еще в разделе: (Показать все результаты (>125) - www.fadr.msu.ru/ )

• Root Traces and the Identification of Paleosols
• Total web report on fadr.msu.ru - Last 12 Months

... JETP Letters, 87 , No. ... On quantum key distribution using ququarts . ... Phys.Rev.A 73 , 063810 (2006) . ... M.V.Chekhova , L.A.Krivitsky and G.A.Maslennikov . ... G.A.Maslennikov , S.P.Merkulova,V.N.Krasheninnikov , and A.N.Penin . ... A.N.Penin , A.V.Burlakov , M.V.Chekhova , D.A.Korystov , Yu.B.Mamaeva , O.A.Karabutova . ... A.V.Burlakov , M.V.Chekhova and A.N.Penin . ... A.N.Penin , M.V.Chekhova and A.V.Burlakov . ... A.N.Penin , D.N.Klyshko , M.V.Chekhova , D.V.Strekalov and Y.H.Shih . ...

Еще в разделе: (Показать все результаты (>98) - qi.phys.msu.ru/ )

• Directions :: Quantum Information Laboratory

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

Third Harmonic Generation in Fishnet Metamaterials M. R. Shcherbkov1, J. Reinhold2, A. S. Shorokhov1, A. Chipouline2, C. Helgert2, T. Pertch2, A. A. Fedyanin1 1 Faculty of Physics, Lomonosov Moscow State University, 119991 Moscow, Russia 2 Friedrich-Schiller-UniversitДt Jena, 07743 Jena, Germany shcherbakov@nanolab.phys.msu.ru Abstract: Optical third harmonic generation in gold-based fishnet metamaterials is studied. ...

Еще в разделе: (Показать все результаты (>66) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/paper_nonlinear.pdf
• Nanophotonics of surface states in photonic crystals | Laboratory of
• Alexander S. Shorokhov | Laboratory of Nanophotonics & Metamaterials

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The present study aims at developing and testing a new generation of sensor materials based on the whiskers of n-type ZnO and SnO2 and immobilized on the surface of oxide clusters p-type CuO, NiO, PdO, to solve the problem of increasing the sensitivity , selectivity and speed sensor materials to toxic and explosive products in the air. ...

Еще в разделе: (Показать все результаты (>38) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... скопировать изображение без склейки слоев (фотошоп) . ... Re: скопировать изображение без склейки слоев (фотошоп) [ re: Weasel ] . ... я бы фотошоп переставил . ... фотошоп ЦС . ...

Еще в разделе: (Показать все результаты (>3104) - www.snto-msu.net/ )

• [OLE Excel]Скопировать строку - Public forum of MSU united student networks
• Не могу скопировать больше 4 гигов - Public forum of MSU united student...
• скопировать DVD, так чтобы смотреть можно было потом - Public forum of MSU

Heat transfer intensification on surfaces with 'eddy generating' relief by subsonic incident flow velocity . ... Scheme of unit for determination of heat transfer and pressure drop coefficients (strain-gauge method) on plates with smooth relief and plates with 'eddy generating' relief . Unit for determination of heat transfer and pressure drop coefficients (strain-gauge method) on plates with smooth relief and plates with 'eddy generating' relief . ...

Еще в разделе: (Показать все результаты (>4) - termogaz.imec.msu.ru/ )

• supersonic dimples_e
• Numeric_e
• scientific results_e