... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... TPPMKOP is an utility developed for the automatic topology generation working well with OPLS-AA force field. ... This database is continually upgrading by our research group. ... OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 8th, 2016 4:27 дп) . ... All-atom automatic OPLS-AA topology generator . ...

Еще в разделе: (Показать все результаты (>58) - erg.biophys.msu.ru/ )

• gromacs ERG Research Group: Лаборатория теоретической биофизики
• topology ERG Research Group: Лаборатория теоретической биофизики
• OPLS ERG Research Group: Лаборатория теоретической биофизики

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Technical >> Development (Archive) . ... Java Swing, Database . ...

Еще в разделе: (Показать все результаты (>3860) - www.snto-msu.net/ )

• Во всех разделах перед списком постов такая фигня: - Public forum of MSU united
• Embedded firebird database - вопрос по скорости - Public forum of MSU united
• mssql, заресторить базу из файла бэкапа - Public forum of MSU united student

.

Еще в разделе: (Показать все результаты (>8) - www.chemport.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... We are recursive, because we also want to fill the fileid cache. Parameters: fileid -- fileid whose path is to be determined. path_list -- existing path components. Ought to be the empty list for the first invocation. if fileid in self . fileid _cache: return self . fileid _cache[ fileid ] debug ( Working with fileid '%s' % ( fileid )) self .dbc.execute( select name , parent_ fileid from + metadata_tbl + where fileid = %s , ( fileid )) result = c.fetchone() if ...

Еще в разделе: (Показать все результаты (>374) - theory.sinp.msu.ru/ )

• [RU-NGI] glite-APEL installation
• Mikhail N. Smolyakov
• [RU-NGI] apel EMI3

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>37) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_db

... Форумы > Книжная барахолка > Тема . ... Форумы Список тем Новая тема . ... Продам: Книгу с курса Microsoft - Administering a Microsoft SQL Server 2000 Database . Продам книжку с официального учебного курса Microsoft . M2072 Administering a Microsoft SQL Server 2000 Database на англиском языке за 200$ c дисками за 265$ (4 диска - 2 учебных и 2 установычных для SQL базы) торг. т.926-529-14-13 . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>35) - www.mmonline.ru/ )

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

Еще в разделе: (Показать все результаты (>34) - srcc.msu.ru/ )

• University Information System RUSSIA
• E. Katkova Docking and postprocessing: application to design of urokinase
• Структура НИВЦ

... A UNIX system has a lot of daemons. a database is the name given to the combination of a program that can manipulate data, together with the data that it acts upon. a record is a set of data about a person or item. Name, telephone number and postcode is an example of such a set. a field is one part of that record; the postcode for example. a delimiter character separates each field from the field preceding it and the field that follows it. ...

Еще в разделе: (Показать все результаты (>53) - comet.sai.msu.ru/ )

• Forcing evaluation of commands
• Digitized Sky Engines
• Index of manual pages: A

Automatic identification of horizontal gene transfer events in bacterial genomes Manolov A.1, Kanygina A. 1 2 Research Institute of Physical and Chemical Medicine, Moscow Moscow Institute of Physics and Technology, Moscow 2 Horizontal gene transfer (HGT) is a major force of bacterial evolution. ... Some of them are based on the multiple alignment of genetic sequences, other perform the search for HGT de novo (having no reference sequence). ...

Еще в разделе: (Показать все результаты (>119) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/194.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>10) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

... Heterogeneous networks of multicomputers and the ch_nexus device . ... The startup files for the ch_nexus device are somewhat different, but easy to understand. ... If you have built MPI with ch_nexus device support on multiple platforms, you may not necessarily have the same startup_dir and startup_exe attribute values. ... The startup_count attribute indicates the number of nodes to be used on the SP-2 (in addition to any nodes you may be using on other workstations or multicomputers). ... Центры ...

Еще в разделе: (Показать все результаты (>158) - www.parallel.ru/ )

... Goals and Tasks . ... Fellows of the Room . ... molecular-genetic study . The Room for Molecular Diagnostics Methods as an independent subdivision of the SIEE was organized in 2003. ... In 2003 a gathering of technical basis of the room was undertaken. й Meschersky, I.G., Chichkina, A.N., Shpak, O.V., Rozhnov, V.V. й A.N. Severtsov Institute of Ecology and Evolution of RAS, 2013 . ... The database will be extended as new samples analysis will done. ...

Еще в разделе: (Показать все результаты (>1243) - www.sevin.ru/ )

• Laboratories: Group for Bioinformatics and Modeling Biological Process:
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News:
• Институт проблем экологии и эволюции имени А.Н. Северцова (ИПЭЭ РАН): Новости:

Peremennye Zvezdy", . ... Min . ... OGLEII CAR-SC01 2765, 2MASS J11052668-6148368 . ... min . Comm. ... OGLEII CAR-SC01 5494, 2MASS J11051146-6144570 . ... OGLEII CAR-SC01 46493, 2MASS J11055923-6150589 . ... OGLEII CAR-SC01 69423, 2MASS J11055898-6122543 . ... OGLEII CAR-SC01 90562, 2MASS J11055545-6058470 . ... OGLEII CAR-SC01 124846, 2MASS J11062757-6113440 . ... OGLEII CAR-SC01 127687, 2MASS J11062902-6110388 . ... OGLEII CAR-SC02 17, 2MASS J11071601-6152001 . ... MinII = 16.83. ...

Еще в разделе: (Показать все результаты (>2507) - www.astronet.ru/ )

• A Force from Empty Space: The Casimir Effect

... To edit pages on this TWikiSite , you must have a registered user name and password. ... This database is accessible to anyone who can access the server through the web (though passwords will be encrypted, and e-mail addresses will be obfusticated to help prevent spamming). ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ...

Еще в разделе: (Показать все результаты (>24464) - dualopt1.cmm.msu.ru/ )

• TWikiRegistration - TWiki - TWiki - (printable)
• CGISessionDriverDBIDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... General Catalog of Variable Stars (GCVS database, Version 2012 Feb.) ... The cross-identification tables of the General Catalogue of Variable Stars (GCVS) contain all GCVS (including extragalactic variables from vol.V), NSV (New catalogue of Suspected Variable stars) and Supplement to the NSV stars as well as stars from the name-lists of variable stars nos. 67 - 80; it also makes it possible to find out identifications between the GCVS and the NSV catalogue. ... I-III) names are included. ...

Еще в разделе: (Показать все результаты (>29) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Help www.sciencedirect.com www.sciencedirect.com R www.sciencedirect.com , ScienceDirect. , (licensed user). ... R PAGE 1 OF 9 www.sciencedirect.com Quick Search, Journals, Books, Reference Works and Abstract Databases Quick Search ( ), Journals (), Reference Works ( ), Books ( ) Abstract Databases ( ). Quick Search ( ) - , . ... ProCite, EndNote Reference Manager). 3a 3a R PAGE 8 OF 9 www.sciencedirect.com 1 Alerts ( ) , , : I Search Alerts ( ); I Journals Issue Alerts ( ); I Citation Alerts ( ). ...

Еще в разделе: (Показать все результаты (>2) - wwwlib.phys.msu.ru/ )

Correlation Engine Portotype V.Pose, JINR Dubna B.Panzer-Steindel, CERN IT Overview The Correlation Engine Prototype was developed during a 3-month work in CERN IT Division financed by the CERN-Intas project. The CERN monitoring prototype, part of the fabric management work package (WP4) of the DataGrid project, gathers monitoring data from farm nodes in CERN into a central monitoring database. ... Two engines are implemented - ayt and procpu. ... connects to such a node using the ayt engine . ...

Еще в разделе: (Показать все результаты (>18) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...