Estimation of the Computational Cost and Analysis of Application of Fuzzy Descriptors in QSAR Problems / Devet'yarov D.A. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>228) - vestnik.math.msu.su/ )

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>4) - physcontrol.phys.msu.ru/ )

... Submit your article . ... The article examines the problems of regional social and demographic management is. ... The author proposes a methodology for assessment of efficiency of the regional social and demographic management. The methodology allows to substantiate specific directions of investment. ... Social and demographic processes, management efficiency, social and demographic transformations and anomalies, socially significant budget items, indicative analysis. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>222) - ee-journal.spa.msu.ru/ )

Arthropoda Selecta 19(1): 79 ї ARTHROPODA SELECTA, 2010 First description of the female of Xerophaeus espoir Platnick, 1981 (Aranei: Gnaphosidae) Первоописание самки Xerophaeus espoir Platnick, 1981 (Aranei: Gnaphosidae) Yuri M. Marusik Ю.М. Марусик Institute for Biological Problems of the North RAS, Portovaya Str. ... Female of Xerophaeus espoir Platnick, 1981 from Seychelles Islands is described for the first time and male is redescribed. ... X.e.: Saaristo & Hill, 2002: 224. ... Platnick N.I. 1981. ...

Еще в разделе: (Показать все результаты (>1455) - zmmu.msu.ru/ )

• Actual problems of modern theriology

... Другие названия журнала: J. Inv. ill-posed problems , J. Inverse and Ill-posed Problems , J. Inverse and Ill-Posed Probl показать полностью.. J. of Inverse and Ill-posed Problems , Journal Inverse and Ill-Posed Problems , Journal of Inverse and Ill-posed Problems . ... Wang Y. , Yagola A.G. в журнале Journal of Inverse and Ill-Posed Problems , издательство V S P (Netherlands) , том 24, ? ... 2012 Numerical method for solving an inverse electrocardiography problem for a quasi stationary case . ...

Еще в разделе: (Показать все результаты (>1501) - istina.msu.ru/ )

• Inverse Problems - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Problems of Information Transmission - журнал | ИСТИНА - Интеллектуальная
• Persoonia - журнал | ИСТИНА - Интеллектуальная Система Тематического

Description and Technical Details . In 1980s two medium-size horizontal solar telescopes 50/35000 cm with large spectrographs Czerny-Turner made by Carl Zeiss Jena were installed in the Ondњejov observatory. The Czerny-Turner-spectrographs in the Ondњejov observatory called HSFA1 and HSFA2 according to the German name Horizontal-Sonnen-Forschungs-Anlage ("horizontal device for solar research") have been explored for more than two decades. ... Diffraction grating - Richardson, Spectra-Physics . ...

Еще в разделе: (Показать все результаты (>229) - lnfm1.sai.msu.ru/ )

• Труды Ширмина Г.И.
• Problems
• Description of Data

... Problems in testing . ... The MPICH test suite, in examples/test , performs a fairly complete test of an MPI implementation. If there is an error, it usually indicates a problem with the implementation of MPI; if you encounter such a problem, please report it to mpi-bugs@mcs.anl.gov . ... Up: Problems in testing Next: Acknowledgments Previous: Problems in testing . ... Q: The test pt2pt/structf fails with . ... A: This is not an error; it is a gap in the MPI definition. ... Центры . ...

Еще в разделе: (Показать все результаты (>293) - www.parallel.ru/ )

• Problems configuring | PARALLEL.RU - Информационно-аналитический центр по
• Problems linking C programs | PARALLEL.RU - Информационно-аналитический центр
• Problems compiling or linking Fortran programs | PARALLEL.RU -

Contamination of soils and deeper sediments by toxic metals, metalloids, and radionuclides is a worldwide problem due to improper disposal practices, spills, atmospheric deposition of combustion emissions, and intentional application of sludges, fertilizers, or other materials. ... Microbial reduction of chromate, for example, may convert highly mobile Cr(VI) to less mobile Cr(III). In other cases, changes in metal redox state may be indirectly caused by microbial activity. ...

Еще в разделе: (Показать все результаты (>33) - eco.soil.msu.ru/ )

• Polluting metals in Russian terrestrial ecosystems: chemistry, dynamics, and

The Scientific Council on Problems of Ecology of Biological Systems (the first name—Scientific Council on Problems of Biogeocenology and Nature Conservation) was found in 1964 by academician V.N.Sukachev. ... elaboration of scientific grounds for ecological prediction, ecological examination and ecologically permissible standards of influence on biological systems; . ... The Scientific Council publicates proceedings of symposiums and conferences, monographs on theoretical and methodical problems. ...

Еще в разделе: (Показать все результаты (>2853) - www.sevin.ru/ )

• Scientific Councils: SCIENTIFIC COUNSIL ON THE PROBLEMS OF BIODETERIORATIONS
• Экологический Форум - Фундаментальная Экология: by way of a different problem
• Экологический Форум - Фундаментальная Экология: through a different problem

Hide Zen home . ... One expect true here, but result is dissapointing false postgres=# select to_tsquery('ob_1','inferences') @@ to_tsvector('ob_1','inference'); ?column? ---------- f (1 row) . ... dictionaries | ... french_ispell,french_stem} | ... inferent} (1 row) postgres=# select * from ts_debug('ob_1','inference'); alias | ... The best way is to teach ispell dictionary, the easiest way is to use synonym dictionary and put it first in the stack of dictionaries: inferences inference . ...

Еще в разделе: (Показать все результаты (>1419) - www.sai.msu.su/ )

• SAI Supernova catalog
• SAL- Mathematics - Statistics -- AD Model Builder
• SAL- Programming - X11 Libraries Toolkits - Imlib

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>29) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

List of Publications . ... Palyulin V.V., Potemkin I.I. Article " Microphase Separation in Melts of Double Comb Copolymers ", Polymer Science, Ser. ... Palyulin V.V., Potemkin I.I., Microphase separation of double-grafted copolymers (centipedes) with gradient, random and regular sequence of the branch points , Journal of Chemical Physics, 2007 , 127, 124903. ( download ) . ... Palyulin V.V., Potemkin I.I., "Microphase separation in double comb copolymer melts , . ... Palyulin V.V., Potemkin I.I., " . ...

Еще в разделе: (Показать все результаты (>159) - polly.phys.msu.ru/ )

• Science
• Publications of S.I. Kuchanov
• Conferences

You are here: Foswiki > System Web > PageOptimizerPlugin (19 Mar 2012, ProjectContributor ) E dit A ttach . ... On this page: . ... http://wiki.cs.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=on (or cache): refresh the css and js cache for the current page . http://wiki.cs.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=css : refresh the css files of the current page . http://wiki.cs.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=js : refresh the js files of the current page . ...

Еще в разделе: (Показать все результаты (>23262) - wiki.cs.msu.ru/ )

• VarENCODE < System < Foswiki
• (backlinks in System Web) VarJQTHEME < System < Foswiki
• (backlinks in all Webs) JQueryTmpl < System < Foswiki

You are here: Foswiki > System Web > PageOptimizerPlugin (19 Mar 2012, ProjectContributor ) E dit A ttach . ... On this page: . ... http://wiki.cmc.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=on (or cache): refresh the css and js cache for the current page . http://wiki.cmc.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=css : refresh the css files of the current page . http://wiki.cmc.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=js : refresh the js files of the current page . ...

Еще в разделе: (Показать все результаты (>48905) - wiki.cmc.msu.ru/ )

• VarENCODE < System < Foswiki

... Программа повышения квалификации ?Исследование природы вместе с детьми? ... День леса - 2013 . ... Содержание сборника, 2004 . ... из сборника Вместе со всей планетой , Пущино 1995 . ... Загадки и тайны мира природы очень интересны детям, даже самым маленьким. ... В 1995 г. мы вместе с учеными подмосковного города Пущино помогали школьникам выступить в роли экологических наставников для малышей . Заметка об этой работе была опубликована в журнале ЮНЕСКО Connect . ...

Еще в разделе: (Показать все результаты (>4) - kids.genebee.msu.ru/ )

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . development of the Automatic solver of mathematical problems . ... Search in Databases . ... Here is a lecture notes in Russian by A.S. Podkolzin " Computer modeling by mathematical problems solving ". ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>121) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Research
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Research

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>73) - www.geol.msu.ru/ )

... Motivations and Problems of Studying Time . ... Deepening of special scientific concepts . ... Measuring the age of natural systems . ... About relative concept of time . ... Problems of the typological concept of time . ... Biological Time, its Organization, Hierarchy and Presentation by Complex Values . ... Mathematical Temporal Constructions . ... Earth Sciences . ... Time As Variability of Natural Systems: Ways of Quantitative Description of Changes and Creation of Changes by Substantial Flows ....

Еще в разделе: (Показать все результаты (>436) - chronos.msu.ru/ )

• Laboratory-chair of modelling the natural references of time
• Laboratory-chair of Discrete mechanics on a microscopic scale
• The Finite and the Infinite: A New view on the problem

... The Second International Astronomy Olympiad . ... Problems to solve, 8-10 Form Text of these problems is available in Russian too. ... Two stars have the same absolute magnitude. ... The orbital period of Mars is 687 days. ... See problem 2. for 8-10 Form. ... Problem to solve, 9-12 Form Text of the problem is available in Russian too. ... Problem is about Doppler-effect, to find velosities of two stars using their spectra and spectrum of our Sun, to estimate speed of the Earth moving around the Sun...

Еще в разделе: (Показать все результаты (>18) - www.issp.ac.ru/ )

• IO of EAAS, Problems to solve (In Russian)
• II IO of EAAS, Problems to solve (In Russian)
• Gavrilov M.G. "Zviozdnyj Mir" (in Russian), problems 339-344

... News from the UNESCO Chair on Global Problems . ... ABOUT THE CHAIR . ... GENERAL INFORMATION ABOUT THE CHAIR . ... STAFF OF THE CHAIR . ... NETWORK OF THE CHAIR . ... Школа ЮНЕСКО / UNESCO SCHOOL . Визит Генерального директора ЮНЕСКО . ... Home News from the UNESCO Chair on Global Problems . ... 2005-2013 Факультет глобальных процессов МГУ имени М.В. Ломоносова / Исполнение и поддержка ресурса: Союз молодых ученых и специалистов Евразии ...

Еще в разделе: (Показать все результаты (>5) - unesco.fgp.msu.ru/ )

• Кафедра ЮНЕСКО по изучению глобальных проблем на факультете глобальных
• ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? GENERAL INFORMATION ABOUT THE CHAIR Кафедра ЮНЕСКО