... The evolution of the two structures in parm99 force fields and parmbsc0 optimized for nucleic acids was analyzed in our adaptation of GROMACS architecture. ... Scheme of 15TGT structure. ... The X ray model of 15TGT changed its initial con formation in both force fields and acquired topology close to the NMR model in a complex with Sr2+ in the parm99 force field [10], while in the parmbsc0 force field the geometry of G quadruplex acquired tepee structure not typical for G quartet (see Fig. ...
[
Текст
]
Ссылки http://dualopt1.cmm.msu.ru/pub/People/ReshRoman/biochimia_2010.pdf -- 461.7 Кб -- 13.04.2011 Похожие документы
Journal of Photochemistry and Photobiology : Biology 29 (1995) 163-170 Role of the centrosome in mitosis: UV micro- irradiation study R.E. Uzbekov, M.S. Votchal, I.A. Vorobjev * Division of Electron Microscopy, A.N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, 119899 Moscow, Russia Abstract Ultraviolet micro- irradiation (UV-MI) of the PK (pig kidney embryo) cell ... In these cells, mitosis was not affected by 1 min irradiation of the spindle pole. ... J. Cell Biol., ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/uzbekov95.pdf -- 1616.3 Кб -- 23.05.2002 Похожие документы
ЖУРНАЛ МОСКОВСКОЙ ПАТРИАРХИИ . ... Встречи Святейшего Патриарха Алексия . ... 2 марта в Патриаршей резиденции в Свято-Даниловом монастыре в Москве состоялась встреча Святейшего Патриарха Московского и всея Руси Алексия с Католикосом-Патриархом всей Грузии Илией II и представителями делегации Грузинской Православной Церкви. ... Сердечно приветствуя гостей из Греции, Святейший Патриарх Алексий с удовлетворением отметил расширение дружественных отношений между Русской и Элладской Православными Церквами. ...
ISSN 1560-3547, Regular and Chaotic Dynamics, 2013, Vol. ... Previously the authors found the separation of variables for this system on the zero level set of a linear (in angular velo city) first integral, whereas in the general case it is not possible to separate the variables. ... EQUATIONS OF MOTION AND FIRST INTEGRALS Consider a system describing the rolling of a rigid b ody whose spherical cavity is in contact with the spherical base (see Fig. ... REGULAR AND CHAOTIC DYNAMICS Vol. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/25c/182-topological-analysis-of-an-integrable-system-related-to-the-rolling-of-a-ball-on-a-sphere_ru.pdf -- 489.4 Кб -- 28.10.2015 Похожие документы
Alexander M. Kuznetsov . ... M.A.Vorotyntsev and A.M.Kuznetsov, On the theory of electrochemical reactions involving the transfer of several electrons, Elektrokhimiya, 6(1970)208-211 . ... A.M.Kuznetsov and Yu.I.Kharkats, A semiclassical theory of adiabatic and nonadiabatic bridge assisted reactions of the electron transfer , Elektrokhimiya, 12(1976)1277-1283 . ... A.M.Kuznetsov, J.Ulstrup, A theory of interrelated electron and proton transfer processes, Elektrokhimiya, 39 (2003) 11-18, No. ...
... The PCRE library is a set of functions that implement regular expression pattern matching using the same syntax and semantics as Perl 5, with just a few differences (see below). ... A regular expression is a pattern that is matched against a subject string from left to right. Most characters stand for themselves in a pattern, and match the corresponding charac- ters in the subject. ... For example, if you want to match a "*" character, you write "\*" in the pattern. ... character class. ...
... В рамках данного спецкурса особый интерес представляют первые две части, которые входят также в книгу "Programming Language Theory and its Implementation". schemers.org . Scheme портал . The Internet Scheme Repository at the Indiana University. An Introduction to Scheme and its Implementation by Prof. Paul R. Wilson . Web and CGI Programming in Scheme . XPath и XSLT на Scheme (SXML). ... Использует Kawa , реализацию Scheme на Java. ...
... V.I.Emelyanov, Yu.V.Vladimirova, "Quantum Physics: Bits and Qubits" (Lomonosov Moscow State University Piblishers, 2012) (In Russian). 176 p. Quantum Optics II , Th. ... 37-46, First Int'l Symp. on Quantum Informatics; Yuri Ozhigov, Ed. (2003). ... J.V.Vladimirova, "Theoretical analysis and computer modeling of coherent dark resonances spectra obtained with the help of high-precision laser spectroscopy", PhD thesis , October 5, 2006, Faculty of Physics, M.V.Lomonosov Moscow state University. ...
... 1 , DOMINO , 0 DOMINO ( 0 ). 2. 0 c = DOMINO ( 0 ) , 0 supp c. 150 . ... PRECALC( , a). ( , ) в , = 1, = min (-1) , , (11) c c supp c ( )supp c = c c supp c min ( )supp c (-1) , . ... supp c , c = arg min (-1) c c supp c ( )supp c . ... PRECALC( , a). : 2 ( ) = arg min , , 2 o dd , c , (-1) c = arg min c c supp c ( )supp c . ... C 4 c = arg (-1) min c ( )supp c c 0 supp c 0 0 . c = arg c 0 c supp c min supp c (-1) . ... 2) = arg min 1) ( , , ) = PRECALC( , a). 0 3) c = DOMINO 4) c. { }. ...
[
Текст
]
Ссылки http://www.intsys.msu.ru/magazine/archive/v13(1-4)/tsymzhitov-141-162.pdf -- 228.7 Кб -- 01.07.2010 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
ABN Abinger HR ABK Abisko HR MIN AAE Addis Ababa HR MIN AGN Agincourt HR ALE Alert HR MIN ABG Alibag HR MIN ASP Alice Springs HR MIN AAA Alma Ata HR ALM Almeria HR AMT Amatsia HR AML Amberley HR AMU Anchorage HR ANN Annamalainagar HR TAN Antananarivo HR MIN API Apia HR MIN ARC Arctowski HR MIN ARK Arkhangelsk HR ARS Arti HR ASC Ascension HR MIN ASO Aso HR BAG Baguio HR BLC Baker Lake HR MIN BNG Bangui HR ...
... BAORB|BA Uccle |Bulletin Astronomique. ... Publ.: ... Spetsial'noj Astrofizicheskoj JAVSO|JAAVSO |Journal of the American Association of Variable Stars Observers JASAC|JASAC |Japan Astronomical Study Association - Circulars JApA |JApAs |Journal of Astrophysics and Astronomy JBAA |JBAA |Journal of the British Astronomical Association JO |JO |Journal des Observateurs JRASC|JRASCan |Journal of the Royal Astronomical Society of Canada JBAn |Jodrell Bank Ann | Astronomical Contributions from the ...
Hyperfine Interact (2013) 219:113120 DOI 10.1007/s10751-013-0812-y MЖssbauer spectroscopy of frozen solutions as a stepwise control tool in preparation of biocompatible humic-stabilized feroxyhyte nanoparticles A. Yu. ... MЖssbauer spectroscopy of frozen solutions as a stepwise.. 115 Fig. ... At the key points of the synthesis aliquot samples of reaction mixture were taken and rapidly frozen by immersion into liquid nitrogen for further low-temperature MЖssbauer studies. ... 117 Fig. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2013/2013-polyakov-etal.pdf -- 378.7 Кб -- 14.01.2014
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2013/2013-polyakov-etal.pdf -- 378.7 Кб -- 14.01.2014 Похожие документы
... The titles of recent E UPOCs are: Poly mers in Nan oscience and Nan otechnology (EUPOC 2005) Bran ched Macrom olecular Struct ures (E UPOC 2006) From Polym er Struct ure an d Rheology t o Process Modeling (EUPOC 2007) Adv anced Polymeric Materials for the Energy Resources Exploitation (E UPOC 2008) · Click -Methods in Polymer and Materials Science (E UPOC 2009) · Hierarchically Struct ured Polym ... Accept ance of presentations w ill be n otified by 1 April 2011. ...
[
Текст
]
Ссылки http://poly.phys.msu.ru/en/news/attach/2010_10_13_eupoc2011.pdf -- 585.3 Кб -- 13.10.2010
[
Текст
]
Ссылки http://polly.phys.msu.ru/en/news/attach/2010_10_13_eupoc2011.pdf -- 585.3 Кб -- 13.10.2010 Похожие документы