AUTOMATED CREATION OF THE LUNAR HYPSOMETRIC MAP: TECHNIQUES OF COMPILING. ... And the second one is the database, obtained from the raster images of the Lunar Subpolar regions (higher than latitude ±60°) where brightness of each pixel depends on its height [1]. ... Due to these reasons it was necessary to develop the special 10-stage methodology of data processing and map compiling. ... The height data were obtained and the lunar hypsometric map was created according to the 10-stage methodology. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>103) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Laz/Publications/6_Automatic%20creation%20of%20the%20hypsometric%20map%20of%20Venus.pdf
• http://selena.sai.msu.ru/Laz/Publications/5_THE%20LUNAR%20SUBPOLAR%20RELIEF%20MAP%20THE%20WAYS%20AND%20TECHNIQUES%20OF%20COM.pdf
• http://selena.sai.msu.ru/Laz/Publications/4_RASTER%20VENUS%20AND%20LUNAR%20MAPS%20AS%20A%20SOURCE%20FOR%20OBTAINING%20VECTOR%20TOPOGRAPHIC%20DATA.pdf

. Published since 1829 . Editor in Chief: A.S. Severtsov . Editorial Board :V.N. Pavlov (Assistant Editor), Yu.A. Dubrovsky, F.Ya. Dzerzhinsky, R.D. Zhantiev, V.G. Krivenko, M.V. Mina, E.N. Mirzoyan, O. P.Poltaruha, D.D.Sokoloff, V.G. Onipchenko, A.V. Sviridov, G.N. Simkin, M.V. Nilova (Secretary), P.S. Tomkovich.

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>502) - herba.msu.ru/ )

• Ñîçäàíèå áàç äàííûõ ïî ôëîðå îñòðîâîâ è îçåð Ñåâåðíîé Êàðåëèè

INTERNET TECHNOLOGIES AND NEW CONCEPTION OF WDCs SYSTEM P.Yu.Pletchov, (Computer Center, RAS, Moscow, Russia, E-mail: lym@ccas.ru) Yu.S.Tyupkin (National Geophysical Committee of Russia Federation and Geophysical Center of RAS, Moscow, Russia, E-mail: tyupkin@wdcb.rssi.ru) In this technical report we wish to discuss the problem of setting up the distributed information system as a part of new conception of World Data Centers system. ... 4) Editing descriptions of an information resource by user. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>492) - geo.web.ru/ )

• http://geo.web.ru/~ariskin/soft/help.html
• http://geo.web.ru/~ariskin/docs/papers/p96_037.pdf
• http://geo.web.ru/COMPASS/geo.html

Next: Binary Radiopulsars with Black Up: Black Holes in Binaries Previous: Black Holes in Binaries . Two different types of stellar BH formation exist: (1) direct core collapse   of a massive star and (2) AIC of a NS. A BH of the first type presumably will have a mass comparable to that of the collapsing star and can be born both from a single star and in a binary system. ... Next: Binary Radiopulsars with Black Up: Black Holes in Binaries Previous: Black Holes in Binaries Mike E. Prokhorov . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>825) - xray.sai.msu.ru/ )

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>413) - monkey.belozersky.msu.ru/ )

... Along with the stable inner proton belt, temporal variations of the 1-15 MeV protons at L=2.5-3.5 have been reported, with intensity increases and decreases registered during and after strong magnetic storms. ... Our study presents experimental evidences that creation and destruction of solar proton belts in the inner magnetosphere may be produced by the fast shifts of the proton penetration boundary without additional acceleration and injection. ... Black line shows the 50-90 MeV proton profiles. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>237) - www.kosmofizika.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>29) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The methodical recommendation on conducting collective classes is addressed to those teachers who wish to assimilate the collective method of teaching. It contains the essence of the method and peculiarities of its application in practice which were formed on the basis of my personal experience and the experience of the teachers of our school. The didactic materials can help teachers to draw up their own materials on other themes of mathematics. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>13957) - www.mce.biophys.msu.ru/ )

... ÝÎÑ èñòôàêà ÌÃÓ . ... x25BA; Êàôåäðà èñòîðè÷åñêîé èíôîðìàòèêè . ... Course categories: Êàôåäðà èñòîðèè ñðåäíèõ âåêîâ Êàôåäðà èñòîðè÷åñêîé èíôîðìàòèêè Êàôåäðà èñòîðè÷åñêîé èíôîðìàòèêè / Ïðàêòèêà èñïîëüçîâàíèÿ ÄÎÒ Êàôåäðà èñòîðèè Ðîññèè äî íà÷àëà XIX âåêà Êàôåäðà íîâîé è íîâåéøåé èñòîðèè ñòðàí Åâðîïû è Àìåðèêè Êàôåäðû ýòíîëîãèè Àðõåîãðàôè÷åñêàÿ ëàáîðàòîðèÿ Øêîëà ó÷èòåëåé èñòîðèè . ... Èíôîðìàöèîííûå òåõíîëîãèè è ìàòåìàòè÷åñêèå ìåòîäû â èñòîðè÷åñêèõ èññëåäîâàíèÿõ è îáðàçîâàíèè . ... Home ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>4349) - www.hist.msu.ru/ )

• ÝÎÑ èñòôàêà ÌÃÓ: Course categories
• Ýëåêòðîííàÿ îáðàçîâàòåëüíàÿ ñðåäà èñòîðè÷åñêîãî ôàêóëüòåòà ÌÃÓ èìåíè
• Summary of Èñòîðèÿ Äðåâíåãî Ìèðà

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>4) - www.kids.genebee.msu.ru/ )

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>10567) - moodle.ffl.msu.ru/ )

Lomonosov Moscow State University . ... Academic Programs . ... Academic Departments Programs . ... Russian Language Program . ... There is a well-known fact that if one doesn't know any foreign languages, he has no notion about his mother tongue. ... Moreover, the academic content is connected with the creation of texts in the Russian language relevant to a plan of a speaker and a writer. ... Address: MSU, Faculty of Foreign Languages and Area Studies, Russia, 119192, Moscow, 31/1, rooms 234-235 . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>1321) - ffl.msu.ru/ )

• Contact Us
• Academic Life

extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>34) - comphep.sinp.msu.ru/ )

• install [CompHEP]
• overview [CompHEP]
• downloads [CompHEP]

... To create a Hysteresys calibration file user should do the following: . Nodal points with known distances between them should be marked using poly line (Curve) on the obtained image of a calibration sample. ... Figure 2.12: Table that allow to define points that are needed for calibration plots generation. ... In this case user should obtain two separate calibration files for fast and slow scanning direction(x-calibration Õ y-calibration-slow). ... Then we should unite these two files in one. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>145) - www.spm.genebee.msu.ru/ )

• FemtoScan Online FAQs
• Macrocommands
• Server

ERROR: You need to create the directory /home/www/hist/vledata with web server write access . ...  íàñòîÿùåå âðåìÿ ìàòåðèàëû äèñòàíöèîííîé ïîääåðæêè ê êóðñàì, ÷èòàþùèìñÿ íà èñòîðè÷åñêîì ôàêóëüòåòå ÌÃÓ èì. Ì.Â.Ëîìîíîñîâà, âû ìîæåòå íàéòè ïî àäðåñó: vle.hist.msu.ru Skip Calendar . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>37613) - hist.msu.ru/ )

... Ãëàâíàÿ -> Ôèëüìû -> And God Created Woman . ... Ôèëüìû . ... And God Created Woman . ... David L?pez . ... Lee Ann Martin . Pat Lee . ... Gary Goetzman . ... Christopher Murray . Gary Grubbs . ... David M. Vigil . David Dean Jr. John Christopher Abeyta . David Borrego . ... Ñâîåíðàâíàÿ êðàñàâèöà Ðîáèí (Ðåáåêêà Äå Ìîðíåé, `Íåóäîáíàÿ æåíùèíà`) - èç òåõ, êòî êòî íàðóøàåò ïðàâèëà è îáîëüùàåò ìóæ÷èí. ... Îí âîçâðàùàåò Ðîáèí â òþðüìó, õîòÿ è î÷àðîâàí åå êðàñîòîé. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>121) - kinfo.ru/ )

• Frankenstein Created Woman - Ôèëüìû - Kinfo.ru
• Why Man Creates - Ôèëüìû - Kinfo.ru
• Other Voices: Creating 'The .. - Ôèëüìû - Kinfo.ru

... Ïîëüçîâàòåëè -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Åäà Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Re: Ïðèíèìàþòüñÿ çàêàçû íà çâ. êàðòû Creative X-Fi exteme music ret. n [ re: Panzer ] . ... Re: Ïðèíèìàþòüñÿ çàêàçû íà çâ. êàðòû Creative X-Fi exteme music ret. n [ re: Je ] . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2724) - www.snto-msu.net/ )

• Re: creative - Public forum of MSU united student networks
• SB Creative ÄÅØÅÂÎ - Public forum of MSU united student networks
• ÏÐÎÄÀÌ ÍÎÂÛÅ ÊÎËÎÍÊÈ Creative Inspire T6100 (5.1) - Public forum of MSU united

... Ïîëüçîâàòåëè -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Åäà Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... íåñïåøíî ïðîäàì Creative X-Fi Notebook . ... Re: íåñïåøíî ïðîäàì Creative X-Fi Notebook [ re: Turist ] . ... Re: íåñïåøíî ïðîäàì Creative X-Fi Notebook [ re: EVFR ] . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>4613) - www.fds-net.ru/ )

• Re: creative - Public forum of MSU united student networks
• Thank you guys for creating this room for us! - Public forum of MSU united
• Ãäå ñêà÷àòü Creative Surround Mixer 5.1? - Public forum of MSU united student

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>69) - lomonosov.sinp.msu.ru/ )