... Agricultural policy implementation: the policy delivery system . ... The unit for studying agricultural policy implementation is the policy delivery system , which we define as being the total modality of implementing a given policy. ... Defining policy objectives . ... Finally, the performance component of the analysis is an assessment of how well the policy delivery system meets the original objective of the policy in terms of delivering the scheduled benefits to the targeted recipients. ...

Еще в разделе: (Показать все результаты (>201) - www.fadr.msu.ru/ )

• REPORT ON INTERNATIONAL SOIL SCIENCE CONGRESS (Montpellier, France, August...
• THE POST-SIMPOSIUM EXCURSION (July 31 - August 7,1998)

... Acoustic Vision with the Nonlinear Scattered Fields . ... It is known that some of objects have strongly nonlinear acoustic responses. ... Different nonlinear acoustic methods   have been developed for diagnostics of such acoustically nonlinear objects. Those methods   allow one mainly to detect acoustically nonlinear inhomogeneities. However for the case when   size of an object is large compared to the wavelength one may suggest methods of nonlinear   acoustic imaging of such objects. ...

Еще в разделе: (Показать все результаты (>350) - acs366.phys.msu.su/ )

• Schedule : Nonlinearity of Media and Structures, Nonlinear Testing
• Nonlinearity of Media and Structures, Nonlinear Testing

. SDPpred: a tool for prediction of amino acid residues . that determine differences in functional specificity of homologous proteins .

Еще в разделе: (Показать все результаты (>6347) - monkey.belozersky.msu.ru/ )

• Inquiry information || Distances
• SDPpred
• About this project

NGS Data Analysis with Unipro UGENE Olga Golosova, Yuriy Vaskin, German Grekhov, Yuliya Algaer UNIPRO, Lavrentieva ave. ... That is where Unipro UGENE NGS framework comes in play. ... Moreover, the UGENE toolkit allows one to automate common tasks by creating workflows with the integrated tools using the UGENE Workflow Designer. Analysis of NGS data with UGENE may start, for example, from quality control of raw NGS data, received from a sequencing facility, with the integrated FastQC [3] tool. ...

Еще в разделе: (Показать все результаты (>326) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/186.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/4.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/14.pdf

Annotation of the graduate work of 6th-year student A.V. Buzmakov Tomography of biological objects with submillimeter resolution using 0.7-2.2 е wavelengths. The progress in such areas as nanotechnology, polymeric technology, microbiology and medical diagnostics, is associated with development of nondestructive methods which allow to recognize objects internal structure, with higher resolution. ... In many cases scientists require 3-D model of density distribution (or X-ray absorption) of object. ...

Еще в разделе: (Показать все результаты (>182) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Dubrovkin_Magnitskii_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2009/Kuratov_Shuvalov_en.pdf

... 2000 December 15 . IC443's Neutron Star . ... Explanation: Using x-ray data from the orbiting Chandra Observatory along with radio data from the Very Large Array , a team of researchers has discovered evidence for a new example of one of the most bizarre objects known to modern astrophysics -- a neutron star . ... The core collapsed when the star, located a reassuring 5,000 light-years away in the constellation Gemini , exploded long ago. How long ago? ... About APOD | ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: 2000 August 30 - The Brown Dwarfs of Orions Trapezium
• APOD: February 7, 1998 - COBE Hotspots: The Oldest Structures Known
• APOD: December 13, 1997 - The Coma Cluster of Galaxies

... Structure, properties, and probable physiological role of small heat shock protein with molecular mass 20 kD (Hsp20, HspB6). ... This review is devoted to critical analysis of data concerning the structure and functions of small heat shock proteins with apparent molecular mass 20 kD (Hsp20). We describe the structure of Hsp20, its phosphorylation by different protein kinases, interaction of Hsp20 with other small heat shock proteins, and chaperone activity of Hsp20. ...

Еще в разделе: (Показать все результаты (>102) - biochem.bio.msu.ru/ )

• [Isotopic effects of low concentration of deuterium in water on biological
• Structure, properties, and functions of the human small heat-shock protein

GEOMETRIC MORPHOMETRICS a numerical approach to analysis of shapes of morphological objects . ... DЭrer`s painting ( XVI ) ' D'Arcy Thompson painting ( X ) 3 SHAPE ANALYSIS = Analytical approaches = morphometrics ­ Principal task is numerical analysis of shapes diversity : Particular tasks: Comparison of shapes themselves Analysis of causes of shapes differences Classification of objects by their shapes 4 SHAPE ANALYSIS = Analytical approaches = ...

Еще в разделе: (Показать все результаты (>1653) - zmmu.msu.ru/ )

• http://zmmu.msu.ru/rjt/articles/ther10_2%20047_058%20Vladimirova.pdf
• Behavioral specialization among group members in the captive mandarin vole,
• Specific functional forms of behavior in pine marten Martes martes, based on

... We consider now change-points in different components of the frequency spectrum of typical EEG signal. ... Only few change-points in power are found in the initial EEG (unless a prominent alpha rhythm is present). ... Change-points in different frequency components of the EEG . ... Change-points in different types of the EEG alpha activity without substantial gradual changes . ... As can be seen from Fig. 7.3, the program reliably detected the change-points despite of such variety of signal patterns...

Еще в разделе: (Показать все результаты (>69) - brain.bio.msu.ru/ )

• Change-points at different levels of the hierarchy of EEG segmental...
• Nonparametric approaches to the description of EEG piecewise stationary
• Other prospects of the change-point based analysis

... создается некое подобие 3-х мерного пространства Слова показа и и отображены таким же способом. -- param name =example_object_0 value = pltext step =20 font =Verdana:28,3 value =%АППЛЕТ% link = exline :0 color =#009999 param name =example_object_1 value = pltext step =20 shifts=2,2 font =Verdana:28,3 value =%АППЛЕТ% link = ...

Еще в разделе: (Показать все результаты (>44) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer2text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer1text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/cursor/cursor2text1.htm

This module provides the ability to set environment variables based upon attributes of the request. ... The mod_setenvif module allows you to set environment variables according to whether different aspects of the request match regular expressions you specify. ... BrowserMatch . ... Syntax: BrowserMatch regex env-variable [= value ] [ env-variable [= value ]] .. ... Module: mod_setenvif . ... The BrowserMatch directive defines environment variables based on the User-Agent HTTP request header field. ...

Еще в разделе: (Показать все результаты (>121) - neptun.sai.msu.ru/ )

• Apache module mod_so
• Source Re-organisation
• Descriptors and Apache

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>117) - scon155.phys.msu.su/ )

• Kinetics of domain structure in ferroelectric thin films
• EXAFS studies of the local structure of In in PbTe, SnTe and GeTe

... About Trac . ... Trac uses a directory structure and a database for storing project data. ... A new Trac environment is created using trac-admin : $ trac-admin /path/to/myproject initenv . ... For example, to connect to a PostgreSQL database on the same machine called trac , that allows access to the user johndoe with the password letmein , use: postgres://johndoe:letmein@localhost/trac . ... Note: don't confuse a Trac environment directory with the source code repository directory. ...

Еще в разделе: (Показать все результаты (>6906) - kodomo.cmm.msu.ru/ )

• InterWiki тАУ Tanchiki

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>38) - cellmotility.genebee.msu.ru/ )

• picture2

Lomonosov Moscow State University, Faculty of Mechanics and Mathematics English Department "It's a Nonlinear World. ... English teacher: .. Department of Differential Equations 1. There are many nonlinear phenomena in our world and therefore nonlinear equations can describe almost everything around us, especially the motion of objects. ... Scientists have carried out special research into the trajectory of different sport balls and derived the size and shape of a perfect ball. ...

Еще в разделе: (Показать все результаты (>24) - www.eng.math.msu.su/ )

... Главная -> Фильмы -> Love Object . ... Фильмы . ... Love Object . ... Robert Parigi . ... John Cassini . ... Кеннетљ? скромный клерк вљодной изљпыльных контор гигантской корпорации. Онљумирает отљстрасти кљкрасотке Лизе, которая будит всељего тайные желания. ... Все, чтољостается Кеннетуљ? купить вљсекс-шопе резиновую куклу.Никиљ? вылитая Лиза, нољпозволит всељи готова кљсамым безумным сексуальным фантазиям Кеннета. Нољвот случилось чудо, иљЛиза отвечает взаимностью Кеннету. ... Кеннет ? ...

Еще в разделе: (Показать все результаты (>168) - kinfo.ru/ )

• The Object of My Affection - Фильмы - Kinfo.ru
• The Objective - Фильмы - Kinfo.ru
• The Object of Beauty - Фильмы - Kinfo.ru

... Recent research of the Laboratory of Photochemistry is concerned mainly with the problems of mechanisms and kinetics of several kinds of photoreactions in homogeneous media and in organized molecular systems. ... Electron Transfer Mechanism Exciplexes . Chain ion-radical reactions of photosubstitution in aromatic compounds . ... Electron transfer mechanisms of exciplex and excimer formation reactions kinetics were studied by fluorescence spectroscopy and flourescence kinetics methods. ...

Еще в разделе: (Показать все результаты (>1233) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 52, No. 5, P. 382 (2011)
• Moscow University Chemistry Bulletin Vol. 47, No. 2, P. 143 (2006)
• Moscow University Chemistry Bulletin Vol. 56, No. 2, P. 91 (2015)

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>265) - www.genebee.msu.ru/ )

• Notes on searching by similarity
• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services Help

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>29) - dynamo.geol.msu.ru/ )

... New approaches to the studies of associating ionic polysaccharides in solution and at interface . Co-ordinator - Professor M.Rinaudo . The main objective of the project is to understand the structure and nature of aggregates formed in aqueous solutions of industrially important ionic polysaccharides: chitosan and hydrophobically modified (HM) chitosan. ... Five research teams (two from INTAS members and three from Russia) with complementary expertise will be involved in the project. ...

Еще в разделе: (Показать все результаты (>362) - polly.phys.msu.ru/ )

• History of Research - Chair of Polymer and Crystal Physics
• Davidich Maria personal homepage
• Seminar in Polymer Physics