Off-centering of impurities is an interesting phenomenon that was discovered in 1965 in KCl crystals doped with Li. ... Investigation of narrow-gap IV-VI semiconductors (mainly lead telluride PbTe and lead selenide PbSe) doped with off-center impurities (like germanium or sulfur) attracts much attention due to impurity-induced phase transitions in these incipient ferroelectrics. ... A.I. Lebedev and I.A. Sluchinskaya. ... A.I. Lebedev, I.A. Sluchinskaya, V.N. Demin and I.H. Munro. ... Russian Acad. ...

Еще в разделе: (Показать все результаты (>92) - scon155.phys.msu.su/ )

• A new method for determining parameters of the potential well of off-center
• Off-centering of Pb and Sn impurities in GeTe
• Direct determination of the shape of potential well for off-center Ge atom in

This diagram shows the relationship between a table and a caption to its left and how they behave in the visual formatting model. The diagram shows a table with 3 columns, one row of headers, and six rows of data cells. The table is centered within its containing block, whose left and right edges are depicted by vertical lines and labeled "current margins". ... To the left of the left containing block edge, a right-justified paragraph of five lines is aligned with the bottom of the table. ...

Еще в разделе: (Показать все результаты (>5115) - crydee.sai.msu.ru/ )

• References
• Dynamic HTML in Communicator
• Long description of example illustrating a table of travel expenses

ft ra D INTERNATIONAL CONFERENCE DAYS ON DIFFRACTION 2015 ABSTRACTS May 25 ­ 29, 2015 St. Petersburg ft ra D ft ra D 176 DAYS on DIFFRACTION 2015 (Fig. 1(a)), we show that in contrary to the free space scenario the uniform wavefronts (Fig. 1(b)). ... Down: Auto correlation function of the laser pulse. ... We measured auto correlation function of the 130-fs laser pulse with tunable central wavelength, which passed through magneto-photonic crystal with the center of micro cavity mo de at the 895 nm. ...

Еще в разделе: (Показать все результаты (>150) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/gulkin_dd15.pdf

... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address:  ed.mos2010@gmail.com .  ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...

Еще в разделе: (Показать все результаты (>15) - ged.chem.msu.ru/ )

... M106: A Spiral Galaxy with a Strange Center . ... Credit Copyright: NASA , ESO , NAOJ , Giovanni Paglioli; Assembling and processing: R. Colombari and R. Gendler Explanation: What's happening at the center of spiral galaxy M106? ... Publications with keywords: M 106 - spiral galaxy - Seyfert galaxy . Publications with words: M 106 - spiral galaxy - Seyfert galaxy . ... Sculptor Galaxy NGC 134 . NGC 3310: A Starburst Spiral Galaxy . ... In the Center of Spiral Galaxy NGC 3521 . ...

Еще в разделе: (Показать все результаты (>14761) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• Monitoring M2-9
• Астронет > Monitoring M2-9

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>133) - sp.cs.msu.ru/ )

• Fortran DVM language description
• C-DVM language description

... Structural modeling of PPI (protein docking) can be roughly divided into: (i) free docking, where sampling of the binding modes is performed regardless of the possible existence of similar experimentally determined structures, and (ii) template-based or comparative docking, where such similar complexes (templates) determine docking predictions. ... 2006) A new measure for functional similarity of gene products based on Gene Ontology, BMC Bioinformatics, 7:302. ...

Еще в разделе: (Показать все результаты (>232) - mccmb.belozersky.msu.ru/ )

• MCCMB'15

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>177) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• TreeTop - Phylogenetic Tree prediction
• Screening by similarity

NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>160) - mgumus.chem.msu.ru/ )

• IHSS-14
• Panasonic Eco Technology Center (PETEC)
• Panasonic Center

... Электронный журнал "Компьютерная графика и мультимедиа" . ... Roadway video passport systems are widely-used for detailed road mapping which allows roadway quality monitoring and repair planning. ... Typical roadway images are strongly differed to each other in colors and texture, some examples are shown below. ... We use so-called rectified images of the road covering. ... When preprocessing is completed our algorithm is trained on a part of rectified road image with the help of user input. ...

Еще в разделе: (Показать все результаты (>336) - graphics.cs.msu.ru/ )

• Road monitoring | Graphics and Media Lab
• Short Reference Image Quality Estimation Using Modified Angular Edge Coherence
• Video Frame Rate N-Times Up-Conversion | Лаборатория компьютерной графики и

... Abstract Submission . ... III International Conference on Heterocyclic Chemistry, . in Honor of the late Professor A.N. Kost's 95th Anniversary . ... To submit an abstract you need to send an e-mail to the address Kost_2010@mail.ru to Yurovskaya Marina Abramovna with attached *.doc files. All accepted abstracts will be published in the Proceedings volume. For the rules how to design the abstracts see below. ... Abstracts without mark will be considered lecture. ...

Еще в разделе: (Показать все результаты (>1675) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 47, No. 3 (2006)
• Moscow University Chemistry Bulletin Vol. 55, No. 4, P. 199 (2014)
• Center of Scientific Information of the Chemistry Department of Moscow State

University Satellites and . Space Science Education . ... Abstract Submission List of submitted abstracts . ... The abstract you have submited . The role of reference frames in the analysis of physical problems. ... Basis are the examples of applied in physics analyses which require defining of the so called reference frames. For each process-phenomenon we try to find a proper reference frames. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6713) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006 I

AN ORIGIN FOR THE SOUTH POLE-AITKEN BASIN THORIUM. ... Moscow University. ... Introduction: The lunar South Pole-Aitken (SPA) impact basin is one of the largest and oldest impact basins and has thus been heavily degraded by postbasin-formation primary impacts and their ejecta [1]. ... The SPA basin thorium map: The using data Lunar Prospector [4] the thorium distribution map demonstrated a hemisphere of the Moon which contains the SPA basin structure and its environs was constructed. ...

Еще в разделе: (Показать все результаты (>116) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Chik/Publications/ms40/17_Chikmachev_etal.pdf
• http://selena.sai.msu.ru/Rod/Publications/ms38/ms035.pdf
• http://selena.sai.msu.ru/Ber/Publications/ms40/09_Berezhnoy_etal.pdf

MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...

Еще в разделе: (Показать все результаты (>30) - www.sciencepark.ru/ )

• MSU Science Park - Prototyping center
• MSU Science Park - Venue & Space

... About CIE MSU . ... Vestnik CIE (in Russian) . ... About Moscow University . ... Center For International Education . ... Homepage > About Center for International Education > . History . ... A new branch of applied linguistics Russian as a foreign language gradually developped. ... In 1991 the Pre-University Faculty was transformed into Center for International Education of Lomonosov Moscow State University (CIE MSU). In 1997 in CIE MSU Testing Center of Russian as a Foreign Language opened. ...

Еще в разделе: (Показать все результаты (>288) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE
• Center for International Education - News Archive
• Center For International Education :: Lomonosov Moscow State University

... February 1, Tuesday . ... EAC Lecture: How to Choose a US University . ... Film: Nothing But a Man (1964) . ... Film: Ayn Rand at 100: Celebrating the Life and Work of a Russian-American Novelist-Philosopher . ... EAC Lecture: Education in the US . February 4, Friday . ... American Center Tour . ... Lecture: International Collaboration in the Arts: Bringing an American Musical to Moscow . ... English One-on-One with Sylvia . ... Happy Valentine\'s Day! . ... EAC Lecture: New Generation SAT . ...

Еще в разделе: (Показать все результаты (>164) - www.prof.msu.ru/ )

• Women in Society (American Center ? March 2004)
• American Center Moscow- November 2006
• American Center Moscow Calendar for May

. Технологии получения новых наноструктурированных материалов и их комплексное исследование . Сайт переместился. Новый адрес ckp-nano.msu.ru .

58. Apache module mod_imap

59. http://www.philol.msu.ru/~rkigf/P_Objavlenija/Konferencii/Konferencii_2011/2011_09_Grec_form2011.pdf

60. Instructions for Authors